Incidental Mutation 'R3697:Nop56'
ID269845
Institutional Source Beutler Lab
Gene Symbol Nop56
Ensembl Gene ENSMUSG00000027405
Gene NameNOP56 ribonucleoprotein
SynonymsNOP56, Nol5a, 2310044F10Rik, 56kDa with KKE/D repeat
MMRRC Submission 040691-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.972) question?
Stock #R3697 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location130274430-130279313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 130277587 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 57 (N57K)
Ref Sequence ENSEMBL: ENSMUSP00000124080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028890] [ENSMUST00000028892] [ENSMUST00000103198] [ENSMUST00000136621] [ENSMUST00000159373] [ENSMUST00000184538]
Predicted Effect probably damaging
Transcript: ENSMUST00000028890
AA Change: N90K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028890
Gene: ENSMUSG00000027405
AA Change: N90K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Nop 44 127 1.1e-26 PFAM
coiled coil region 131 176 N/A INTRINSIC
low complexity region 185 204 N/A INTRINSIC
low complexity region 213 228 N/A INTRINSIC
low complexity region 242 264 N/A INTRINSIC
low complexity region 280 292 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028892
SMART Domains Protein: ENSMUSP00000028892
Gene: ENSMUSG00000027406

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
Iso_dh 49 375 1.43e-140 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083355
Predicted Effect probably damaging
Transcript: ENSMUST00000103198
AA Change: N374K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099487
Gene: ENSMUSG00000027405
AA Change: N374K

DomainStartEndE-ValueType
Pfam:NOP5NT 5 70 4.3e-20 PFAM
NOSIC 167 219 1.18e-30 SMART
internal_repeat_1 257 305 4.06e-5 PROSPERO
coiled coil region 415 460 N/A INTRINSIC
low complexity region 469 488 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 526 548 N/A INTRINSIC
low complexity region 564 576 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133351
Predicted Effect probably benign
Transcript: ENSMUST00000136621
SMART Domains Protein: ENSMUSP00000124616
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:NOP5NT 4 70 3.6e-22 PFAM
NOSIC 167 219 1.18e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138163
Predicted Effect probably benign
Transcript: ENSMUST00000141872
SMART Domains Protein: ENSMUSP00000125305
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:NOP5NT 14 79 3.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145335
Predicted Effect unknown
Transcript: ENSMUST00000146454
AA Change: N118K
SMART Domains Protein: ENSMUSP00000125304
Gene: ENSMUSG00000027405
AA Change: N118K

DomainStartEndE-ValueType
Pfam:Nop 1 152 7.8e-66 PFAM
coiled coil region 159 204 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149843
Predicted Effect probably benign
Transcript: ENSMUST00000149955
SMART Domains Protein: ENSMUSP00000123879
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
NOSIC 2 35 1.24e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000150401
AA Change: N69K
SMART Domains Protein: ENSMUSP00000123890
Gene: ENSMUSG00000027405
AA Change: N69K

DomainStartEndE-ValueType
Pfam:Nop 26 103 3.9e-26 PFAM
coiled coil region 110 155 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153353
Predicted Effect probably damaging
Transcript: ENSMUST00000159373
AA Change: N57K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124080
Gene: ENSMUSG00000027405
AA Change: N57K

DomainStartEndE-ValueType
Pfam:Nop 10 94 6e-28 PFAM
coiled coil region 98 135 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162063
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175746
Predicted Effect probably benign
Transcript: ENSMUST00000184538
SMART Domains Protein: ENSMUSP00000139331
Gene: ENSMUSG00000027406

DomainStartEndE-ValueType
Pfam:Iso_dh 6 71 1.8e-15 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nop56p is a yeast nucleolar protein that is part of a complex with the nucleolar proteins Nop58p and fibrillarin. Nop56p is required for assembly of the 60S ribosomal subunit and is involved in pre-rRNA processing. The protein encoded by this gene is similar in sequence to Nop56p and is also found in the nucleolus. Expansion of a GGCCTG repeat from 3-8 copies to 1500-2500 copies in an intron of this gene results in spinocerebellar ataxia 36. Multiple transcript variants encoding several different isoforms have been found for this gene, but the full-length nature of most of them has not been determined. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh4a1 A G 4: 139,642,251 H371R possibly damaging Het
Arhgef4 A G 1: 34,722,440 D259G unknown Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Clcn3 T C 8: 60,913,123 D805G probably benign Het
Cnmd C A 14: 79,637,981 R333L probably damaging Het
Col4a4 A T 1: 82,541,237 I79N unknown Het
Emc1 T G 4: 139,365,386 S546A possibly damaging Het
Ermard T C 17: 15,053,376 S408P probably benign Het
Gls C T 1: 52,199,764 M364I possibly damaging Het
Gm16380 A G 9: 53,884,452 noncoding transcript Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Il6st T G 13: 112,504,382 D897E probably benign Het
Itga3 T C 11: 95,062,725 T233A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lemd3 CCCTCCTCCTCCTCCTCCTCC CCCTCCTCCTCCTCCTCC 10: 120,978,527 probably benign Het
Miga1 T C 3: 152,322,436 N152S probably damaging Het
Nckipsd G A 9: 108,811,121 G83S probably damaging Het
Nedd4 T C 9: 72,740,187 F728L probably damaging Het
Nid1 G A 13: 13,486,759 C748Y probably damaging Het
Nup205 A G 6: 35,188,711 N197S probably benign Het
Pglyrp3 T A 3: 92,028,174 C244S probably damaging Het
Rgs22 C T 15: 36,099,892 V226I probably benign Het
Rtp3 T A 9: 110,987,194 R96S possibly damaging Het
Serpinb8 A T 1: 107,607,146 K316* probably null Het
Sp6 C A 11: 97,021,754 P98T possibly damaging Het
Vmn1r15 A T 6: 57,258,336 D63V possibly damaging Het
Vmn1r216 G A 13: 23,099,679 W177* probably null Het
Zfp414 CAAACTCTTCCGA CAAACTCTTCCGAAACTCTTCCGA 17: 33,630,577 probably null Het
Other mutations in Nop56
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Nop56 APN 2 130275995 missense possibly damaging 0.77
IGL02330:Nop56 APN 2 130276766 missense probably damaging 0.99
IGL02939:Nop56 APN 2 130278197 missense probably damaging 1.00
IGL03149:Nop56 APN 2 130277525 missense probably damaging 1.00
IGL03046:Nop56 UTSW 2 130275569 unclassified probably benign
R0421:Nop56 UTSW 2 130276772 missense possibly damaging 0.96
R1405:Nop56 UTSW 2 130277948 missense probably benign 0.22
R1405:Nop56 UTSW 2 130277948 missense probably benign 0.22
R1713:Nop56 UTSW 2 130277966 missense possibly damaging 0.85
R2202:Nop56 UTSW 2 130277568 missense probably damaging 1.00
R2203:Nop56 UTSW 2 130277568 missense probably damaging 1.00
R2204:Nop56 UTSW 2 130277568 missense probably damaging 1.00
R4114:Nop56 UTSW 2 130276673 unclassified probably null
R4679:Nop56 UTSW 2 130278273 missense probably benign 0.36
R4788:Nop56 UTSW 2 130278900 missense probably benign 0.05
R4792:Nop56 UTSW 2 130277864 missense possibly damaging 0.96
R4999:Nop56 UTSW 2 130275725 missense probably benign 0.00
R5889:Nop56 UTSW 2 130275982 missense probably damaging 1.00
R6016:Nop56 UTSW 2 130276625 critical splice donor site probably null
R6389:Nop56 UTSW 2 130277887 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGTGAGGTAGAAAGTTCAGCC -3'
(R):5'- TTCACTCAGACCCAAGGTGTC -3'

Sequencing Primer
(F):5'- AAGTTCAGCCAAGCCTGGTG -3'
(R):5'- GGTGTCAACACTCACTAGGTG -3'
Posted On2015-03-18