Mutagenetix > Incidental Mutation

Incidental Mutation 'R3698:Nfu1'

269890

Institutional Source

Beutler Lab

Gene Symbol

Nfu1

Ensembl Gene

ENSMUSG00000029993

Gene Name

NFU1 iron-sulfur cluster scaffold

Synonyms

CGI-33, Hirip5, 0610006G17Rik

Accession Numbers

Essential gene?

Probably essential (E-score: 0.856) question?

Stock #

R3698 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86986218-87005443 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86992634 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 83 (T83A)

Ref Sequence

ENSEMBL: ENSMUSP00000113637 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032060] [ENSMUST00000117583] [ENSMUST00000120240] [ENSMUST00000144776]

AlphaFold

Q9QZ23

Predicted Effect

probably damaging
Transcript: ENSMUST00000032060
AA Change: T83A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000032060
Gene: ENSMUSG00000029993
AA Change: T83A

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
Nfu_N	59	146	1.91e-48	SMART
low complexity region	147	166	N/A	INTRINSIC
Pfam:NifU	174	240	3.2e-29	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000117583
AA Change: T83A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113332
Gene: ENSMUSG00000029993
AA Change: T83A

Domain	Start	End	E-Value	Type
Nfu_N	3	90	1.91e-48	SMART
low complexity region	95	112	N/A	INTRINSIC
Pfam:NifU	117	185	2e-24	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000120240
AA Change: T83A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113637
Gene: ENSMUSG00000029993
AA Change: T83A

Domain	Start	End	E-Value	Type
Nfu_N	3	90	1.91e-48	SMART
low complexity region	91	110	N/A	INTRINSIC
Pfam:NifU	118	186	2e-24	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127819

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140343

Predicted Effect

possibly damaging
Transcript: ENSMUST00000144776
AA Change: T83A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000121746
Gene: ENSMUSG00000029993
AA Change: T83A

Domain	Start	End	E-Value	Type
Nfu_N	3	163	7.18e-21	SMART
low complexity region	164	183	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203512

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205018

Meta Mutation Damage Score

0.5596

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized to mitochondria and plays a critical role in iron-sulfur cluster biogenesis. The encoded protein assembles and transfers 4Fe-4S clusters to target apoproteins including succinate dehydrogenase and lipoic acid synthase. Mutations in this gene are a cause of multiple mitochondrial dysfunctions syndrome-1, and pseudogenes of this gene are located on the short arms of chromosomes 1 and 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afap1l2	C	A	19: 56,904,955 (GRCm39)	S549I	possibly damaging	Het
Aldh4a1	A	G	4: 139,369,562 (GRCm39)	H371R	possibly damaging	Het
Arpc1a	G	T	5: 145,033,001 (GRCm39)	K103N	probably damaging	Het
Btg3	A	G	16: 78,161,722 (GRCm39)	S136P	probably benign	Het
Ckap5	C	A	2: 91,450,511 (GRCm39)	T2014K	probably benign	Het
Dennd10	A	G	19: 60,821,054 (GRCm39)		probably null	Het
Emc1	T	G	4: 139,092,697 (GRCm39)	S546A	possibly damaging	Het
G3bp2	T	C	5: 92,204,139 (GRCm39)	E316G	possibly damaging	Het
Il12a	TCAC	TC	3: 68,605,320 (GRCm39)		probably null	Het
Il6st	T	G	13: 112,640,916 (GRCm39)	D897E	probably benign	Het
Ipo13	A	G	4: 117,757,890 (GRCm39)	L767P	probably damaging	Het
Kcnd3	C	T	3: 105,566,082 (GRCm39)	A421V	probably damaging	Het
Klhl13	G	A	X: 23,114,422 (GRCm39)	T94I	probably benign	Het
Morc2a	A	T	11: 3,629,672 (GRCm39)	K364*	probably null	Het
Nat8f2	T	A	6: 85,844,778 (GRCm39)	T195S	probably benign	Het
Nckipsd	G	A	9: 108,688,320 (GRCm39)	G83S	probably damaging	Het
Nid1	G	A	13: 13,661,344 (GRCm39)	C748Y	probably damaging	Het
Or1af1	C	T	2: 37,110,188 (GRCm39)	P229L	probably damaging	Het
Or5w15	T	C	2: 87,568,360 (GRCm39)	T103A	probably benign	Het
Rgs22	C	T	15: 36,100,038 (GRCm39)	V226I	probably benign	Het
Slc13a4	T	A	6: 35,251,892 (GRCm39)	I467F	probably benign	Het
Stat2	T	A	10: 128,114,662 (GRCm39)	L253Q	probably benign	Het
Tnxb	G	T	17: 34,909,407 (GRCm39)		probably null	Het
Ttn	C	T	2: 76,564,595 (GRCm39)	R28514H	probably damaging	Het
Usp15	T	C	10: 123,017,643 (GRCm39)	D51G	probably damaging	Het
Uvrag	T	C	7: 98,589,150 (GRCm39)	E417G	probably damaging	Het

Other mutations in Nfu1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:Nfu1	APN	6	86,992,577 (GRCm39)	missense	probably damaging	1.00
IGL00467:Nfu1	APN	6	86,997,755 (GRCm39)	missense	possibly damaging	0.91
IGL00676:Nfu1	APN	6	86,992,581 (GRCm39)	missense	probably damaging	1.00
IGL01798:Nfu1	APN	6	86,992,605 (GRCm39)	missense	probably damaging	1.00
R0583:Nfu1	UTSW	6	86,986,934 (GRCm39)	missense	probably benign	0.01
R1584:Nfu1	UTSW	6	86,997,791 (GRCm39)	missense	probably damaging	0.99
R3696:Nfu1	UTSW	6	86,992,634 (GRCm39)	missense	probably damaging	1.00
R4659:Nfu1	UTSW	6	86,996,408 (GRCm39)	missense	probably damaging	0.98
R5623:Nfu1	UTSW	6	86,993,188 (GRCm39)	small deletion	probably benign
R5679:Nfu1	UTSW	6	86,996,379 (GRCm39)	missense	probably damaging	1.00
R5823:Nfu1	UTSW	6	87,002,541 (GRCm39)	missense	probably damaging	0.98
R6898:Nfu1	UTSW	6	86,994,034 (GRCm39)	splice site	probably null
R7002:Nfu1	UTSW	6	86,993,254 (GRCm39)	missense	probably benign	0.00
R7122:Nfu1	UTSW	6	86,986,863 (GRCm39)	unclassified	probably benign
R8747:Nfu1	UTSW	6	86,996,400 (GRCm39)	missense	probably damaging	1.00
R8804:Nfu1	UTSW	6	86,993,414 (GRCm39)	intron	probably benign
R9311:Nfu1	UTSW	6	86,986,926 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGGTTTCCTCAACGCTGCTG -3'
(R):5'- GAACTGTCAAATACACTCCTGAGG -3'

Sequencing Primer
(F):5'- TCAACGCTGCTGGCACATG -3'
(R):5'- CCTGCCCACAAACTGTG -3'

Posted On

2015-03-18