Incidental Mutation 'R3698:Il6st'
ID 269897
Institutional Source Beutler Lab
Gene Symbol Il6st
Ensembl Gene ENSMUSG00000021756
Gene Name interleukin 6 signal transducer
Synonyms 5133400A03Rik, CD130, gp130, D13Ertd699e
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3698 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 112600604-112643394 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 112640916 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 897 (D897E)
Ref Sequence ENSEMBL: ENSMUSP00000139227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070731] [ENSMUST00000183513] [ENSMUST00000183663] [ENSMUST00000183829] [ENSMUST00000184276] [ENSMUST00000184311] [ENSMUST00000184949] [ENSMUST00000184445]
AlphaFold Q00560
Predicted Effect probably benign
Transcript: ENSMUST00000070731
AA Change: D897E

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000064205
Gene: ENSMUSG00000021756
AA Change: D897E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 26 112 1.4e-30 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 407 1.07e1 SMART
FN3 422 503 6.1e0 SMART
FN3 517 600 4.81e-4 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 718 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183513
SMART Domains Protein: ENSMUSP00000139016
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183663
AA Change: D897E

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000138836
Gene: ENSMUSG00000021756
AA Change: D897E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 1.2e-32 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 407 1.07e1 SMART
FN3 422 503 6.1e0 SMART
FN3 517 600 4.81e-4 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 718 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183829
SMART Domains Protein: ENSMUSP00000138987
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PDB:1I1R|A 23 52 7e-8 PDB
FN3 56 142 7.23e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184276
SMART Domains Protein: ENSMUSP00000139060
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 2.3e-33 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184311
AA Change: D897E

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139227
Gene: ENSMUSG00000021756
AA Change: D897E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 1.2e-32 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 407 1.07e1 SMART
FN3 422 503 6.1e0 SMART
FN3 517 600 4.81e-4 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 718 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184949
AA Change: D836E

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000138915
Gene: ENSMUSG00000021756
AA Change: D836E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 9.4e-33 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 442 6.97e0 SMART
FN3 456 539 4.81e-4 SMART
transmembrane domain 557 579 N/A INTRINSIC
low complexity region 657 692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184445
SMART Domains Protein: ENSMUSP00000139311
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 2e-33 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
Meta Mutation Damage Score 0.0639 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a signal transducer shared by many cytokines, including interleukin 6 (IL6), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), and oncostatin M (OSM). This protein functions as a part of the cytokine receptor complex. The activation of this protein is dependent upon the binding of cytokines to their receptors. vIL6, a protein related to IL6 and encoded by the Kaposi sarcoma-associated herpesvirus, can bypass the interleukin 6 receptor (IL6R) and directly activate this protein. Knockout studies in mice suggest that this gene plays a critical role in regulating myocyte apoptosis. Alternatively spliced transcript variants have been described. A related pseudogene has been identified on chromosome 17. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for targeted null mutations show myocardial and hematological defects and die between embryonic day 12.5 and term. Conditional mutants show female infertility and neurological, cardiac, hematopoietic, immunological, hepatic, and lung defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 C A 19: 56,904,955 (GRCm39) S549I possibly damaging Het
Aldh4a1 A G 4: 139,369,562 (GRCm39) H371R possibly damaging Het
Arpc1a G T 5: 145,033,001 (GRCm39) K103N probably damaging Het
Btg3 A G 16: 78,161,722 (GRCm39) S136P probably benign Het
Ckap5 C A 2: 91,450,511 (GRCm39) T2014K probably benign Het
Dennd10 A G 19: 60,821,054 (GRCm39) probably null Het
Emc1 T G 4: 139,092,697 (GRCm39) S546A possibly damaging Het
G3bp2 T C 5: 92,204,139 (GRCm39) E316G possibly damaging Het
Il12a TCAC TC 3: 68,605,320 (GRCm39) probably null Het
Ipo13 A G 4: 117,757,890 (GRCm39) L767P probably damaging Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Klhl13 G A X: 23,114,422 (GRCm39) T94I probably benign Het
Morc2a A T 11: 3,629,672 (GRCm39) K364* probably null Het
Nat8f2 T A 6: 85,844,778 (GRCm39) T195S probably benign Het
Nckipsd G A 9: 108,688,320 (GRCm39) G83S probably damaging Het
Nfu1 A G 6: 86,992,634 (GRCm39) T83A probably damaging Het
Nid1 G A 13: 13,661,344 (GRCm39) C748Y probably damaging Het
Or1af1 C T 2: 37,110,188 (GRCm39) P229L probably damaging Het
Or5w15 T C 2: 87,568,360 (GRCm39) T103A probably benign Het
Rgs22 C T 15: 36,100,038 (GRCm39) V226I probably benign Het
Slc13a4 T A 6: 35,251,892 (GRCm39) I467F probably benign Het
Stat2 T A 10: 128,114,662 (GRCm39) L253Q probably benign Het
Tnxb G T 17: 34,909,407 (GRCm39) probably null Het
Ttn C T 2: 76,564,595 (GRCm39) R28514H probably damaging Het
Usp15 T C 10: 123,017,643 (GRCm39) D51G probably damaging Het
Uvrag T C 7: 98,589,150 (GRCm39) E417G probably damaging Het
Other mutations in Il6st
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Il6st APN 13 112,617,967 (GRCm39) splice site probably null
IGL00571:Il6st APN 13 112,624,394 (GRCm39) missense probably damaging 1.00
IGL01151:Il6st APN 13 112,630,185 (GRCm39) missense probably benign 0.00
IGL01336:Il6st APN 13 112,616,773 (GRCm39) missense possibly damaging 0.71
IGL01501:Il6st APN 13 112,616,593 (GRCm39) missense probably benign 0.22
IGL01512:Il6st APN 13 112,640,900 (GRCm39) missense probably benign 0.36
IGL01657:Il6st APN 13 112,618,077 (GRCm39) missense probably damaging 1.00
IGL01863:Il6st APN 13 112,640,744 (GRCm39) missense possibly damaging 0.88
IGL01916:Il6st APN 13 112,616,606 (GRCm39) missense possibly damaging 0.90
IGL01978:Il6st APN 13 112,633,891 (GRCm39) missense possibly damaging 0.51
IGL02089:Il6st APN 13 112,631,774 (GRCm39) missense probably benign 0.12
IGL02752:Il6st APN 13 112,616,729 (GRCm39) missense probably damaging 0.98
IGL02988:Il6st UTSW 13 112,635,420 (GRCm39) missense probably damaging 1.00
R0019:Il6st UTSW 13 112,637,682 (GRCm39) missense possibly damaging 0.94
R0550:Il6st UTSW 13 112,611,648 (GRCm39) splice site probably null
R0606:Il6st UTSW 13 112,640,806 (GRCm39) missense possibly damaging 0.78
R1126:Il6st UTSW 13 112,640,266 (GRCm39) missense probably damaging 1.00
R1452:Il6st UTSW 13 112,617,998 (GRCm39) missense possibly damaging 0.79
R1581:Il6st UTSW 13 112,618,075 (GRCm39) missense probably damaging 0.99
R1632:Il6st UTSW 13 112,640,866 (GRCm39) missense possibly damaging 0.86
R1881:Il6st UTSW 13 112,640,947 (GRCm39) missense probably damaging 1.00
R2013:Il6st UTSW 13 112,635,423 (GRCm39) missense probably null 0.94
R2043:Il6st UTSW 13 112,616,753 (GRCm39) missense probably benign 0.00
R2128:Il6st UTSW 13 112,640,709 (GRCm39) missense probably benign 0.01
R2137:Il6st UTSW 13 112,639,392 (GRCm39) missense possibly damaging 0.92
R3433:Il6st UTSW 13 112,640,365 (GRCm39) missense probably damaging 1.00
R3696:Il6st UTSW 13 112,640,916 (GRCm39) missense probably benign 0.13
R3697:Il6st UTSW 13 112,640,916 (GRCm39) missense probably benign 0.13
R4172:Il6st UTSW 13 112,631,861 (GRCm39) missense probably benign 0.25
R4543:Il6st UTSW 13 112,617,993 (GRCm39) missense probably damaging 1.00
R4641:Il6st UTSW 13 112,625,064 (GRCm39) missense probably damaging 1.00
R4838:Il6st UTSW 13 112,627,044 (GRCm39) nonsense probably null
R4899:Il6st UTSW 13 112,637,695 (GRCm39) missense probably damaging 1.00
R4922:Il6st UTSW 13 112,639,399 (GRCm39) missense probably damaging 0.98
R5088:Il6st UTSW 13 112,627,089 (GRCm39) missense probably damaging 1.00
R5104:Il6st UTSW 13 112,625,182 (GRCm39) missense probably benign 0.02
R5853:Il6st UTSW 13 112,618,071 (GRCm39) missense probably damaging 1.00
R6602:Il6st UTSW 13 112,640,947 (GRCm39) missense probably damaging 1.00
R7082:Il6st UTSW 13 112,640,566 (GRCm39) missense probably damaging 1.00
R7101:Il6st UTSW 13 112,631,907 (GRCm39) critical splice donor site probably null
R7192:Il6st UTSW 13 112,631,741 (GRCm39) missense probably benign 0.00
R7273:Il6st UTSW 13 112,631,832 (GRCm39) missense probably benign 0.37
R7330:Il6st UTSW 13 112,630,185 (GRCm39) missense probably benign 0.00
R7427:Il6st UTSW 13 112,625,094 (GRCm39) missense probably benign 0.01
R7770:Il6st UTSW 13 112,639,338 (GRCm39) missense probably damaging 1.00
R8086:Il6st UTSW 13 112,631,094 (GRCm39) splice site probably null
R8307:Il6st UTSW 13 112,624,281 (GRCm39) missense probably benign 0.16
R8831:Il6st UTSW 13 112,640,914 (GRCm39) missense probably damaging 1.00
R9041:Il6st UTSW 13 112,611,631 (GRCm39) missense probably benign 0.00
R9189:Il6st UTSW 13 112,635,340 (GRCm39) missense probably damaging 1.00
R9316:Il6st UTSW 13 112,639,349 (GRCm39) missense possibly damaging 0.95
R9409:Il6st UTSW 13 112,640,872 (GRCm39) missense probably benign 0.00
R9763:Il6st UTSW 13 112,627,051 (GRCm39) missense probably damaging 1.00
U24488:Il6st UTSW 13 112,631,168 (GRCm39) missense possibly damaging 0.90
Z1176:Il6st UTSW 13 112,630,152 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGGTTTTGTCCGGCAATGAG -3'
(R):5'- GCTACTCTGGAATGGAGACG -3'

Sequencing Primer
(F):5'- CAATGAGGAGGATTTTGTCAGACTG -3'
(R):5'- GCCCAGGTGTGACTTTGTCC -3'
Posted On 2015-03-18