Mutagenetix > Incidental Mutation

Incidental Mutation 'R3699:Rere'

269913

Institutional Source

Beutler Lab

Gene Symbol

Rere

Ensembl Gene

ENSMUSG00000039852

Gene Name

arginine glutamic acid dipeptide (RE) repeats

Synonyms

eye, eyes3, Atr2, atrophin-2, 1110033A15Rik

MMRRC Submission

040692-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3699 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

150366103-150706423 bp(+) (GRCm39)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to T at 150561819 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000101307 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105682]

AlphaFold

Q80TZ9

Predicted Effect

probably null
Transcript: ENSMUST00000105682

SMART Domains

Protein: ENSMUSP00000101307
Gene: ENSMUSG00000039852

Domain	Start	End	E-Value	Type
low complexity region	3	31	N/A	INTRINSIC
low complexity region	52	65	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
BAH	103	283	3.52e-13	SMART
ELM2	286	338	1.67e-13	SMART
SANT	392	441	1.8e-6	SMART
low complexity region	444	461	N/A	INTRINSIC
ZnF_GATA	501	552	1.94e-15	SMART
Pfam:Atrophin-1	568	1557	N/A	PFAM

Meta Mutation Damage Score

0.9492

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the atrophin family of arginine-glutamic acid (RE) dipeptide repeat-containing proteins. The encoded protein co-localizes with a transcription factor in the nucleus, and its overexpression triggers apoptosis. A similar protein in mouse associates with histone deacetylase and is thought to function as a transcriptional co-repressor during embryonic development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality with abnormalities in neural tube development, somite development, and in the embryonic heart. Mice homozygous for an ENU-induced allele exhibit narrow snouts, decreased body weight, renal agenesis and small eyes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd29	G	A	18: 12,387,757 (GRCm39)	A275V	possibly damaging	Het
Atp1b2	G	A	11: 69,496,095 (GRCm39)	T35I	probably benign	Het
Baz1a	A	G	12: 54,963,831 (GRCm39)	V751A	probably benign	Het
Cdh23	C	A	10: 60,163,149 (GRCm39)		probably null	Het
Chd2	G	T	7: 73,118,238 (GRCm39)	L1127I	probably benign	Het
D7Ertd443e	A	G	7: 133,950,797 (GRCm39)	L292P	probably damaging	Het
Dst	T	C	1: 34,252,155 (GRCm39)		probably benign	Het
Dync2i1	C	T	12: 116,175,462 (GRCm39)	W905*	probably null	Het
Gm8229	T	A	14: 44,603,984 (GRCm39)	S58T	unknown	Het
Gucy2c	A	T	6: 136,747,109 (GRCm39)	C117S	probably damaging	Het
Kirrel1	C	T	3: 86,996,458 (GRCm39)	M380I	probably null	Het
Klhl18	A	G	9: 110,265,134 (GRCm39)	Y291H	probably benign	Het
Lamc1	G	T	1: 153,130,951 (GRCm39)	S333R	possibly damaging	Het
Lbr	T	C	1: 181,646,485 (GRCm39)	Y479C	probably damaging	Het
Nampt	T	C	12: 32,898,758 (GRCm39)		probably benign	Het
Or10am5	A	G	7: 6,517,993 (GRCm39)	M145T	probably damaging	Het
Pcnx3	G	T	19: 5,722,493 (GRCm39)	R1400S	probably damaging	Het
Pde4b	C	T	4: 102,458,742 (GRCm39)	A466V	probably damaging	Het
Piezo1	C	T	8: 123,221,642 (GRCm39)	R584H	probably damaging	Het
Polq	C	A	16: 36,862,518 (GRCm39)	S338Y	probably damaging	Het
Pramel26	A	G	4: 143,536,922 (GRCm39)	S470P	probably benign	Het
Rassf8	T	C	6: 145,765,802 (GRCm39)		probably benign	Het
Rps6kb1	A	G	11: 86,423,620 (GRCm39)	F120S	probably damaging	Het
Scarf1	G	T	11: 75,405,195 (GRCm39)	C78F	probably damaging	Het
Tepsin	C	T	11: 119,982,579 (GRCm39)	C491Y	possibly damaging	Het
Trpv4	A	G	5: 114,772,861 (GRCm39)	S243P	probably damaging	Het
Whrn	A	T	4: 63,379,649 (GRCm39)		probably benign	Het
Zfp521	G	T	18: 13,979,330 (GRCm39)	S361*	probably null	Het
Zfyve19	A	G	2: 119,041,720 (GRCm39)	T96A	probably benign	Het

Other mutations in Rere

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Rere	APN	4	150,703,920 (GRCm39)	missense	probably damaging	1.00
IGL01465:Rere	APN	4	150,594,451 (GRCm39)	missense	unknown
IGL01523:Rere	APN	4	150,700,012 (GRCm39)	missense	possibly damaging	0.93
IGL01688:Rere	APN	4	150,702,893 (GRCm39)	missense	probably damaging	1.00
IGL02057:Rere	APN	4	150,699,289 (GRCm39)	unclassified	probably benign
IGL02621:Rere	APN	4	150,698,269 (GRCm39)	unclassified	probably benign
IGL02672:Rere	APN	4	150,594,483 (GRCm39)	missense	unknown
R0116:Rere	UTSW	4	150,701,433 (GRCm39)	missense	probably benign	0.18
R0119:Rere	UTSW	4	150,699,779 (GRCm39)	unclassified	probably benign
R0344:Rere	UTSW	4	150,695,438 (GRCm39)	unclassified	probably benign
R0504:Rere	UTSW	4	150,699,779 (GRCm39)	unclassified	probably benign
R0630:Rere	UTSW	4	150,703,545 (GRCm39)	missense	probably damaging	1.00
R0961:Rere	UTSW	4	150,699,829 (GRCm39)	unclassified	probably benign
R1164:Rere	UTSW	4	150,619,341 (GRCm39)	missense	unknown
R1424:Rere	UTSW	4	150,701,495 (GRCm39)	missense	probably damaging	1.00
R1542:Rere	UTSW	4	150,700,399 (GRCm39)	missense	probably damaging	1.00
R1652:Rere	UTSW	4	150,696,522 (GRCm39)	unclassified	probably benign
R1953:Rere	UTSW	4	150,701,294 (GRCm39)	missense	probably damaging	1.00
R1959:Rere	UTSW	4	150,553,247 (GRCm39)	missense	probably benign	0.23
R1966:Rere	UTSW	4	150,701,330 (GRCm39)	missense	probably damaging	1.00
R1975:Rere	UTSW	4	150,700,190 (GRCm39)	missense	probably damaging	0.99
R2070:Rere	UTSW	4	150,699,047 (GRCm39)	unclassified	probably benign
R2115:Rere	UTSW	4	150,697,018 (GRCm39)	unclassified	probably benign
R2144:Rere	UTSW	4	150,701,388 (GRCm39)	missense	probably damaging	0.99
R2270:Rere	UTSW	4	150,561,837 (GRCm39)	missense	unknown
R2969:Rere	UTSW	4	150,654,673 (GRCm39)	missense	unknown
R3723:Rere	UTSW	4	150,553,252 (GRCm39)	missense	probably damaging	1.00
R3826:Rere	UTSW	4	150,554,785 (GRCm39)	missense	probably benign	0.42
R4234:Rere	UTSW	4	150,701,862 (GRCm39)	missense	probably damaging	1.00
R4512:Rere	UTSW	4	150,561,909 (GRCm39)	missense	unknown
R4798:Rere	UTSW	4	150,699,624 (GRCm39)	unclassified	probably benign
R4883:Rere	UTSW	4	150,700,510 (GRCm39)	missense	probably damaging	0.98
R4914:Rere	UTSW	4	150,703,601 (GRCm39)	missense	probably damaging	1.00
R4916:Rere	UTSW	4	150,703,601 (GRCm39)	missense	probably damaging	1.00
R4917:Rere	UTSW	4	150,703,601 (GRCm39)	missense	probably damaging	1.00
R4918:Rere	UTSW	4	150,703,601 (GRCm39)	missense	probably damaging	1.00
R4966:Rere	UTSW	4	150,698,273 (GRCm39)	unclassified	probably benign
R5172:Rere	UTSW	4	150,654,726 (GRCm39)	missense	unknown
R5643:Rere	UTSW	4	150,701,700 (GRCm39)	missense	probably damaging	1.00
R6058:Rere	UTSW	4	150,553,255 (GRCm39)	missense	probably damaging	1.00
R7112:Rere	UTSW	4	150,491,061 (GRCm39)	missense	probably benign
R7173:Rere	UTSW	4	150,553,195 (GRCm39)	missense	probably damaging	1.00
R7190:Rere	UTSW	4	150,695,410 (GRCm39)	missense	unknown
R7699:Rere	UTSW	4	150,701,555 (GRCm39)	missense
R7990:Rere	UTSW	4	150,699,327 (GRCm39)	missense	unknown
R8070:Rere	UTSW	4	150,701,832 (GRCm39)	missense	probably damaging	1.00
R8101:Rere	UTSW	4	150,701,796 (GRCm39)	missense	probably damaging	1.00
R8103:Rere	UTSW	4	150,701,796 (GRCm39)	missense	probably damaging	1.00
R8215:Rere	UTSW	4	150,701,424 (GRCm39)	missense	possibly damaging	0.95
R8254:Rere	UTSW	4	150,697,129 (GRCm39)	missense	unknown
R8348:Rere	UTSW	4	150,703,653 (GRCm39)	missense	probably damaging	1.00
R8448:Rere	UTSW	4	150,703,653 (GRCm39)	missense	probably damaging	1.00
R8725:Rere	UTSW	4	150,701,792 (GRCm39)	nonsense	probably null
R8790:Rere	UTSW	4	150,593,332 (GRCm39)	missense	unknown
R8921:Rere	UTSW	4	150,696,471 (GRCm39)	missense	unknown
R8937:Rere	UTSW	4	150,699,331 (GRCm39)	unclassified	probably benign
R9345:Rere	UTSW	4	150,554,770 (GRCm39)	missense	probably damaging	0.99
R9377:Rere	UTSW	4	150,593,342 (GRCm39)	missense	unknown
R9490:Rere	UTSW	4	150,516,040 (GRCm39)	missense	probably benign	0.16
R9523:Rere	UTSW	4	150,703,636 (GRCm39)	missense	probably damaging	0.98
R9653:Rere	UTSW	4	150,516,010 (GRCm39)	missense	probably benign	0.28
R9657:Rere	UTSW	4	150,699,390 (GRCm39)	missense	unknown
Z1176:Rere	UTSW	4	150,553,240 (GRCm39)	missense	probably damaging	1.00
Z1177:Rere	UTSW	4	150,700,268 (GRCm39)	missense

Predicted Primers

PCR Primer
(F):5'- ATTCTCCTGTGATACTTTATGGGGC -3'
(R):5'- AAGCGCTGAGTCACTGCTTG -3'

Sequencing Primer
(F):5'- TGATACTTTATGGGGCTTACTGAAG -3'
(R):5'- CTGCTTGGCATCTAACTTAAGCACAG -3'

Posted On

2015-03-18