Incidental Mutation 'R3700:Arhgap28'
ID269979
Institutional Source Beutler Lab
Gene Symbol Arhgap28
Ensembl Gene ENSMUSG00000024043
Gene NameRho GTPase activating protein 28
Synonyms
MMRRC Submission 040693-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R3700 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location67842713-68004120 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67901366 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 36 (S36G)
Ref Sequence ENSEMBL: ENSMUSP00000128194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024840] [ENSMUST00000163865] [ENSMUST00000164647]
Predicted Effect probably damaging
Transcript: ENSMUST00000024840
AA Change: S86G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000024840
Gene: ENSMUSG00000024043
AA Change: S86G

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
RhoGAP 400 578 1.41e-34 SMART
Blast:RhoGAP 583 612 2e-7 BLAST
Blast:RhoGAP 640 681 9e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000163865
AA Change: S36G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130960
Gene: ENSMUSG00000024043
AA Change: S36G

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
RhoGAP 350 527 7.1e-31 SMART
Blast:RhoGAP 532 561 1e-7 BLAST
Blast:RhoGAP 589 630 8e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000164647
AA Change: S36G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128194
Gene: ENSMUSG00000024043
AA Change: S36G

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
RhoGAP 350 528 1.41e-34 SMART
Blast:RhoGAP 533 562 1e-7 BLAST
Blast:RhoGAP 590 631 8e-6 BLAST
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 98% (51/52)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal bone length and ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 G A 18: 65,305,151 T1524I probably damaging Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arhgap26 T A 18: 39,120,184 F221L probably damaging Het
Bcl11a A G 11: 24,163,890 D411G probably damaging Het
Cdh23 C A 10: 60,327,370 probably null Het
Cnnm2 T A 19: 46,762,551 I260N probably damaging Het
Coro6 T C 11: 77,467,303 F238S probably damaging Het
Ddah1 G A 3: 145,891,495 M162I probably benign Het
Dnah5 T C 15: 28,387,791 I3132T possibly damaging Het
Eif3f A T 7: 108,940,275 I251F probably benign Het
Ephx4 T C 5: 107,402,807 F11L probably benign Het
Esp1 T C 17: 40,731,107 S97P unknown Het
Fbxw10 A T 11: 62,869,157 probably null Het
Hsp90ab1 T C 17: 45,571,514 T85A possibly damaging Het
Idh2 T C 7: 80,099,147 K129E probably damaging Het
Kcnj6 A G 16: 94,833,006 I64T probably damaging Het
Klk5 T A 7: 43,850,827 C280S probably damaging Het
Lhx2 T A 2: 38,360,099 L269H probably damaging Het
Lrrc71 T A 3: 87,745,878 probably null Het
Lss T A 10: 76,546,192 L484Q probably damaging Het
Mmp14 G A 14: 54,431,932 probably benign Het
Muc5b A G 7: 141,847,249 T534A unknown Het
Mysm1 T C 4: 94,970,652 K87E probably benign Het
Olfr213 T A 6: 116,540,528 V25E probably benign Het
Olfr523 C G 7: 140,176,214 F37L possibly damaging Het
Pcolce T C 5: 137,609,047 T61A probably damaging Het
Phc3 C A 3: 30,914,128 D920Y probably damaging Het
Pi4kb T C 3: 94,994,288 I422T probably benign Het
Piezo1 C T 8: 122,494,903 R584H probably damaging Het
Plce1 T A 19: 38,705,337 F768Y probably damaging Het
Ppp1r21 T C 17: 88,582,454 S709P possibly damaging Het
Prdx6 T C 1: 161,247,288 D74G probably damaging Het
Prrxl1 A T 14: 32,628,861 E218V probably damaging Het
Rlf A G 4: 121,150,863 F307L possibly damaging Het
Skiv2l T C 17: 34,849,903 E40G probably benign Het
Snapin G A 3: 90,490,192 R91* probably null Het
Sort1 T A 3: 108,356,639 L838* probably null Het
Sstr4 A G 2: 148,396,353 I295V possibly damaging Het
Stk39 T A 2: 68,392,118 I201F probably damaging Het
Tasp1 T C 2: 139,910,554 T322A probably benign Het
Tepsin C T 11: 120,091,753 C491Y possibly damaging Het
Tlr9 G A 9: 106,224,079 V190M probably damaging Het
Ttf2 A G 3: 100,951,008 L755P probably damaging Het
Txn2 G A 15: 77,927,776 T60M possibly damaging Het
Vmn1r10 A G 6: 57,114,302 N293S probably benign Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r111 C T 17: 22,571,161 W288* probably null Het
Vmn2r118 T C 17: 55,608,421 S510G possibly damaging Het
Wdr60 C T 12: 116,211,842 W905* probably null Het
Zgpat T A 2: 181,365,646 probably benign Het
Zzef1 G T 11: 72,886,772 G1810C probably null Het
Other mutations in Arhgap28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Arhgap28 APN 17 67845801 missense probably damaging 1.00
IGL01388:Arhgap28 APN 17 67853039 unclassified probably benign
IGL01560:Arhgap28 APN 17 67896071 missense probably damaging 1.00
IGL01578:Arhgap28 APN 17 67858200 missense probably benign 0.00
IGL01650:Arhgap28 APN 17 67873132 missense probably damaging 0.97
IGL02383:Arhgap28 APN 17 67896089 missense probably benign 0.00
IGL02403:Arhgap28 APN 17 67873159 missense possibly damaging 0.87
IGL02652:Arhgap28 APN 17 67884800 missense probably benign 0.00
IGL03102:Arhgap28 APN 17 67896236 missense probably damaging 1.00
IGL03209:Arhgap28 APN 17 67868956 missense probably damaging 1.00
IGL03306:Arhgap28 APN 17 67852935 missense probably damaging 1.00
K3955:Arhgap28 UTSW 17 68004006 missense probably damaging 0.98
R0135:Arhgap28 UTSW 17 67864588 missense probably damaging 1.00
R0309:Arhgap28 UTSW 17 67901429 missense probably benign 0.13
R0385:Arhgap28 UTSW 17 67864606 missense probably damaging 1.00
R0412:Arhgap28 UTSW 17 67896258 missense probably damaging 1.00
R0463:Arhgap28 UTSW 17 67896225 missense probably damaging 1.00
R0626:Arhgap28 UTSW 17 67896113 unclassified probably null
R0691:Arhgap28 UTSW 17 67896164 unclassified probably null
R0811:Arhgap28 UTSW 17 67901299 small deletion probably benign
R1150:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1151:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1152:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1426:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1427:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1632:Arhgap28 UTSW 17 67849074 missense probably damaging 0.99
R1747:Arhgap28 UTSW 17 67901309 missense probably benign 0.02
R1951:Arhgap28 UTSW 17 67901341 missense probably benign 0.00
R2031:Arhgap28 UTSW 17 67896116 missense probably damaging 1.00
R2126:Arhgap28 UTSW 17 67869015 missense possibly damaging 0.90
R2181:Arhgap28 UTSW 17 67896117 missense probably damaging 1.00
R3800:Arhgap28 UTSW 17 67873036 missense probably damaging 1.00
R3811:Arhgap28 UTSW 17 67896093 missense probably benign
R4213:Arhgap28 UTSW 17 67871993 missense probably benign 0.04
R4347:Arhgap28 UTSW 17 67873142 missense probably benign
R4954:Arhgap28 UTSW 17 67869013 nonsense probably null
R5592:Arhgap28 UTSW 17 67858272 missense probably damaging 0.99
R5610:Arhgap28 UTSW 17 67896240 nonsense probably null
R5758:Arhgap28 UTSW 17 67873159 missense probably benign 0.04
R5774:Arhgap28 UTSW 17 67881492 missense possibly damaging 0.94
R6413:Arhgap28 UTSW 17 67875588 missense probably benign 0.00
R6661:Arhgap28 UTSW 17 67845751 missense probably damaging 1.00
R6928:Arhgap28 UTSW 17 67901299 small deletion probably benign
Z1088:Arhgap28 UTSW 17 67861277 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AGGCCCAGTCTGTTTGAAG -3'
(R):5'- CACAGGCACCCAGTTTCATTC -3'

Sequencing Primer
(F):5'- GCCCAGTCTGTTTGAAGAAAAAG -3'
(R):5'- GGCACCCAGTTTCATTCAAATG -3'
Posted On2015-03-18