Incidental Mutation 'R3735:Kcnj10'
ID270031
Institutional Source Beutler Lab
Gene Symbol Kcnj10
Ensembl Gene ENSMUSG00000044708
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 10
SynonymsBIR10, Kir4.1, Kir1.2, Kir4.1, BIRK-1
MMRRC Submission 040722-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3735 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location172341210-172374085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 172369966 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 349 (Y349C)
Ref Sequence ENSEMBL: ENSMUSP00000054356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056136]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056136
AA Change: Y349C

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054356
Gene: ENSMUSG00000044708
AA Change: Y349C

DomainStartEndE-ValueType
Pfam:IRK 31 363 2.2e-136 PFAM
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inward rectifier-type potassium channel family, characterized by having a greater tendency to allow potassium to flow into, rather than out of, a cell. The encoded protein may form a heterodimer with another potassium channel protein and may be responsible for the potassium buffering action of glial cells in the brain. Mutations in this gene have been associated with seizure susceptibility of common idiopathic generalized epilepsy syndromes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice show increased input resistance and high depolarization of retinal Muller cells, loss of the endocochlear potential, motor coordination deficits and hindlimb paralysis, and a hypomyelination and spongiform vacuolation in the spinalcord associated with severe axonal pathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A T 5: 30,482,098 Y123F probably benign Het
4921539E11Rik C G 4: 103,266,406 E90Q probably damaging Het
Acadl G A 1: 66,853,289 A125V probably benign Het
Acot12 T A 13: 91,784,346 I487N probably benign Het
Acox3 A G 5: 35,611,153 K686R probably benign Het
Adam17 T C 12: 21,325,412 D802G probably benign Het
Aoc3 A T 11: 101,332,219 D427V probably damaging Het
Bivm C T 1: 44,126,434 H15Y probably benign Het
C8a T C 4: 104,817,615 E509G probably benign Het
Ccdc158 A C 5: 92,632,424 L930R possibly damaging Het
Cdca7 T A 2: 72,483,865 probably null Het
Cep170b A T 12: 112,741,004 I395F probably damaging Het
Champ1 T C 8: 13,878,735 S298P probably damaging Het
Cyp2j8 T A 4: 96,444,599 R503S probably damaging Het
Dcaf10 C T 4: 45,348,117 T191I probably benign Het
Dido1 A G 2: 180,684,036 probably benign Het
Dnah7b C T 1: 46,299,875 T3361I probably benign Het
Dync1h1 G A 12: 110,631,675 V1767I probably benign Het
Eml5 G A 12: 98,855,989 T721I possibly damaging Het
F8 G A X: 75,211,375 P2138S probably damaging Het
Fam169b G T 7: 68,350,301 R198S probably damaging Het
Gm7694 A G 1: 170,302,761 S23P probably damaging Het
Grk3 T A 5: 112,953,831 T248S probably benign Het
Helq T G 5: 100,790,188 D464A possibly damaging Het
Ido2 C T 8: 24,535,193 V273M probably damaging Het
Il12rb1 T C 8: 70,817,218 L518P probably damaging Het
Kansl1l A G 1: 66,801,250 V297A possibly damaging Het
Krt18 A G 15: 102,028,501 T75A probably benign Het
Lrmp G A 6: 145,160,870 probably benign Het
Lrp4 A T 2: 91,498,371 I1539F probably damaging Het
Map3k6 T C 4: 133,246,372 V458A probably benign Het
Med12l T A 3: 59,091,495 H614Q probably damaging Het
Med13 A C 11: 86,279,658 M1850R probably benign Het
Mfsd13a A G 19: 46,368,328 Y256C probably damaging Het
Mogs C A 6: 83,116,776 T242K possibly damaging Het
Myo9b T C 8: 71,348,597 V1133A probably benign Het
Myom2 A T 8: 15,069,676 H144L probably benign Het
Ncapg A T 5: 45,696,127 Q906L probably benign Het
Nkx1-1 C T 5: 33,433,730 V83I unknown Het
Npy4r T A 14: 34,147,269 T21S probably benign Het
Nup88 A G 11: 70,956,192 S331P probably damaging Het
Olfr1294 T A 2: 111,537,896 H131L probably damaging Het
Olr1 T A 6: 129,499,875 probably benign Het
Osmr A T 15: 6,822,080 Y656N probably damaging Het
Otogl A T 10: 107,899,529 Y131* probably null Het
Pgr G A 9: 8,901,533 G356S probably damaging Het
Prdm2 T C 4: 143,134,359 E787G probably damaging Het
Prpf18 A G 2: 4,643,673 I114T probably benign Het
R3hdm2 T A 10: 127,465,010 I280N probably benign Het
Rims4 T C 2: 163,863,985 D243G possibly damaging Het
Rmnd5a T C 6: 71,396,862 D316G possibly damaging Het
Rpap2 T C 5: 107,655,151 probably benign Het
Sdr16c5 G A 4: 4,005,614 T240I probably benign Het
Shroom3 T C 5: 92,964,444 V1888A possibly damaging Het
Slc36a4 T A 9: 15,738,273 Y466* probably null Het
Slco3a1 A G 7: 74,504,497 I80T probably damaging Het
Sptlc2 G A 12: 87,341,565 A381V probably benign Het
Stam A T 2: 14,129,012 Q190L probably damaging Het
Suclg2 T A 6: 95,497,696 I363F probably damaging Het
Tacstd2 A G 6: 67,534,859 V283A probably damaging Het
Tln1 G T 4: 43,549,370 A616E probably damaging Het
Trdmt1 A T 2: 13,519,873 F257Y possibly damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,814,790 probably null Het
Trps1 A G 15: 50,846,060 I298T possibly damaging Het
Tti2 T C 8: 31,155,897 L413P probably damaging Het
Utrn A G 10: 12,478,484 V343A probably damaging Het
Vwf G T 6: 125,588,613 W288L probably damaging Het
Zfp629 T A 7: 127,612,778 probably benign Het
Zfp873 G A 10: 82,061,181 S582N probably benign Het
Zfp979 A G 4: 147,613,482 Y257H possibly damaging Het
Zfpm1 G A 8: 122,323,736 C117Y possibly damaging Het
Other mutations in Kcnj10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01771:Kcnj10 APN 1 172369583 missense probably benign 0.11
IGL02743:Kcnj10 APN 1 172369654 missense possibly damaging 0.95
R0052:Kcnj10 UTSW 1 172368924 missense probably benign 0.30
R0490:Kcnj10 UTSW 1 172369452 missense probably damaging 0.96
R1424:Kcnj10 UTSW 1 172369255 missense probably damaging 1.00
R2153:Kcnj10 UTSW 1 172369888 missense possibly damaging 0.90
R3826:Kcnj10 UTSW 1 172370049 missense probably damaging 1.00
R4725:Kcnj10 UTSW 1 172369159 missense probably damaging 1.00
R4726:Kcnj10 UTSW 1 172369072 missense probably damaging 1.00
R4727:Kcnj10 UTSW 1 172369699 missense probably damaging 1.00
R5434:Kcnj10 UTSW 1 172369480 missense probably damaging 1.00
R5755:Kcnj10 UTSW 1 172369594 missense possibly damaging 0.81
R6146:Kcnj10 UTSW 1 172369325 nonsense probably null
R7029:Kcnj10 UTSW 1 172368996 missense probably benign 0.07
R7235:Kcnj10 UTSW 1 172369426 missense probably damaging 0.98
R7350:Kcnj10 UTSW 1 172369260 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TAAAAGATCTCCCGCTCCGC -3'
(R):5'- AGCGAACCCAGATTGTATCC -3'

Sequencing Primer
(F):5'- GCTGATCCTGAGTGGGACAG -3'
(R):5'- AGATTGTATCCTTTTCCCAGAGCAC -3'
Posted On2015-03-18