Incidental Mutation 'R3735:Med12l'
ID270041
Institutional Source Beutler Lab
Gene Symbol Med12l
Ensembl Gene ENSMUSG00000056476
Gene Namemediator complex subunit 12-like
Synonyms
MMRRC Submission 040722-MU
Accession Numbers

NCBI RefSeq: NM_177855.3; MGI: 2139916

Is this an essential gene? Possibly non essential (E-score: 0.480) question?
Stock #R3735 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location59005825-59318682 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59091495 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 614 (H614Q)
Ref Sequence ENSEMBL: ENSMUSP00000142903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029393] [ENSMUST00000040325] [ENSMUST00000040846] [ENSMUST00000085040] [ENSMUST00000164225] [ENSMUST00000199659]
Predicted Effect probably damaging
Transcript: ENSMUST00000029393
AA Change: H625Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029393
Gene: ENSMUSG00000056476
AA Change: H625Q

DomainStartEndE-ValueType
Med12 101 172 1.54e-17 SMART
low complexity region 227 235 N/A INTRINSIC
low complexity region 280 289 N/A INTRINSIC
Pfam:Med12-LCEWAV 293 737 1.6e-200 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000040325
AA Change: H614Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476
AA Change: H614Q

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000040846
AA Change: H625Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041859
Gene: ENSMUSG00000056476
AA Change: H625Q

DomainStartEndE-ValueType
Med12 101 172 1.54e-17 SMART
low complexity region 227 235 N/A INTRINSIC
low complexity region 280 289 N/A INTRINSIC
Pfam:Med12-LCEWAV 293 728 9e-201 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085040
SMART Domains Protein: ENSMUSP00000082115
Gene: ENSMUSG00000050075

DomainStartEndE-ValueType
Pfam:7tm_1 31 285 4e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164225
AA Change: H614Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476
AA Change: H614Q

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199659
AA Change: H614Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476
AA Change: H614Q

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Meta Mutation Damage Score 0.29 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the Mediator complex, which is involved in transcriptional coactivation of nearly all RNA polymerase II-dependent genes. The Mediator complex links gene-specific transcriptional activators with the basal transcription machinery. [provided by RefSeq, May 2010]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A T 5: 30,482,098 Y123F probably benign Het
4921539E11Rik C G 4: 103,266,406 E90Q probably damaging Het
Acadl G A 1: 66,853,289 A125V probably benign Het
Acot12 T A 13: 91,784,346 I487N probably benign Het
Acox3 A G 5: 35,611,153 K686R probably benign Het
Adam17 T C 12: 21,325,412 D802G probably benign Het
Aoc3 A T 11: 101,332,219 D427V probably damaging Het
Bivm C T 1: 44,126,434 H15Y probably benign Het
C8a T C 4: 104,817,615 E509G probably benign Het
Ccdc158 A C 5: 92,632,424 L930R possibly damaging Het
Cdca7 T A 2: 72,483,865 probably null Het
Cep170b A T 12: 112,741,004 I395F probably damaging Het
Champ1 T C 8: 13,878,735 S298P probably damaging Het
Cyp2j8 T A 4: 96,444,599 R503S probably damaging Het
Dcaf10 C T 4: 45,348,117 T191I probably benign Het
Dido1 A G 2: 180,684,036 probably benign Het
Dnah7b C T 1: 46,299,875 T3361I probably benign Het
Dync1h1 G A 12: 110,631,675 V1767I probably benign Het
Eml5 G A 12: 98,855,989 T721I possibly damaging Het
F8 G A X: 75,211,375 P2138S probably damaging Het
Fam169b G T 7: 68,350,301 R198S probably damaging Het
Gm7694 A G 1: 170,302,761 S23P probably damaging Het
Grk3 T A 5: 112,953,831 T248S probably benign Het
Helq T G 5: 100,790,188 D464A possibly damaging Het
Ido2 C T 8: 24,535,193 V273M probably damaging Het
Il12rb1 T C 8: 70,817,218 L518P probably damaging Het
Kansl1l A G 1: 66,801,250 V297A possibly damaging Het
Kcnj10 A G 1: 172,369,966 Y349C possibly damaging Het
Krt18 A G 15: 102,028,501 T75A probably benign Het
Lrmp G A 6: 145,160,870 probably benign Het
Lrp4 A T 2: 91,498,371 I1539F probably damaging Het
Map3k6 T C 4: 133,246,372 V458A probably benign Het
Med13 A C 11: 86,279,658 M1850R probably benign Het
Mfsd13a A G 19: 46,368,328 Y256C probably damaging Het
Mogs C A 6: 83,116,776 T242K possibly damaging Het
Myo9b T C 8: 71,348,597 V1133A probably benign Het
Myom2 A T 8: 15,069,676 H144L probably benign Het
Ncapg A T 5: 45,696,127 Q906L probably benign Het
Nkx1-1 C T 5: 33,433,730 V83I unknown Het
Npy4r T A 14: 34,147,269 T21S probably benign Het
Nup88 A G 11: 70,956,192 S331P probably damaging Het
Olfr1294 T A 2: 111,537,896 H131L probably damaging Het
Olr1 T A 6: 129,499,875 probably benign Het
Osmr A T 15: 6,822,080 Y656N probably damaging Het
Otogl A T 10: 107,899,529 Y131* probably null Het
Pgr G A 9: 8,901,533 G356S probably damaging Het
Prdm2 T C 4: 143,134,359 E787G probably damaging Het
Prpf18 A G 2: 4,643,673 I114T probably benign Het
R3hdm2 T A 10: 127,465,010 I280N probably benign Het
Rims4 T C 2: 163,863,985 D243G possibly damaging Het
Rmnd5a T C 6: 71,396,862 D316G possibly damaging Het
Rpap2 T C 5: 107,655,151 probably benign Het
Sdr16c5 G A 4: 4,005,614 T240I probably benign Het
Shroom3 T C 5: 92,964,444 V1888A possibly damaging Het
Slc36a4 T A 9: 15,738,273 Y466* probably null Het
Slco3a1 A G 7: 74,504,497 I80T probably damaging Het
Sptlc2 G A 12: 87,341,565 A381V probably benign Het
Stam A T 2: 14,129,012 Q190L probably damaging Het
Suclg2 T A 6: 95,497,696 I363F probably damaging Het
Tacstd2 A G 6: 67,534,859 V283A probably damaging Het
Tln1 G T 4: 43,549,370 A616E probably damaging Het
Trdmt1 A T 2: 13,519,873 F257Y possibly damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,814,790 probably null Het
Trps1 A G 15: 50,846,060 I298T possibly damaging Het
Tti2 T C 8: 31,155,897 L413P probably damaging Het
Utrn A G 10: 12,478,484 V343A probably damaging Het
Vwf G T 6: 125,588,613 W288L probably damaging Het
Zfp629 T A 7: 127,612,778 probably benign Het
Zfp873 G A 10: 82,061,181 S582N probably benign Het
Zfp979 A G 4: 147,613,482 Y257H possibly damaging Het
Zfpm1 G A 8: 122,323,736 C117Y possibly damaging Het
Other mutations in Med12l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Med12l APN 3 59042336 missense probably damaging 0.98
IGL00561:Med12l APN 3 59227824 missense probably benign
IGL00974:Med12l APN 3 59083014 missense probably damaging 1.00
IGL01024:Med12l APN 3 59073341 missense probably damaging 1.00
IGL01094:Med12l APN 3 59093655 missense probably damaging 0.99
IGL01134:Med12l APN 3 59042275 missense possibly damaging 0.91
IGL01535:Med12l APN 3 59262259 missense probably damaging 1.00
IGL01653:Med12l APN 3 59261893 missense probably damaging 1.00
IGL01735:Med12l APN 3 59263254 missense probably damaging 1.00
IGL01972:Med12l APN 3 59261893 missense probably damaging 1.00
IGL02005:Med12l APN 3 59244947 missense probably damaging 1.00
IGL02098:Med12l APN 3 59275855 missense possibly damaging 0.92
IGL02115:Med12l APN 3 59068319 missense probably benign 0.00
IGL02231:Med12l APN 3 59245882 missense probably damaging 1.00
IGL02259:Med12l APN 3 59245843 missense probably damaging 1.00
IGL02369:Med12l APN 3 59257373 missense probably benign 0.00
IGL02424:Med12l APN 3 59092722 missense probably benign 0.21
IGL02501:Med12l APN 3 59261976 missense possibly damaging 0.71
IGL02525:Med12l APN 3 59068368 missense probably benign 0.01
IGL02530:Med12l APN 3 59077089 missense probably damaging 1.00
IGL02735:Med12l APN 3 59093646 missense probably damaging 1.00
IGL02865:Med12l APN 3 59294292 missense probably damaging 1.00
IGL03183:Med12l APN 3 59037555 splice site probably null
IGL03264:Med12l APN 3 59301367 nonsense probably null
FR4304:Med12l UTSW 3 59275982 small insertion probably benign
FR4340:Med12l UTSW 3 59275985 small insertion probably benign
FR4342:Med12l UTSW 3 59275988 small insertion probably benign
FR4342:Med12l UTSW 3 59275994 small insertion probably benign
FR4449:Med12l UTSW 3 59275963 nonsense probably null
FR4548:Med12l UTSW 3 59275982 small insertion probably benign
FR4589:Med12l UTSW 3 59275956 small insertion probably benign
FR4976:Med12l UTSW 3 59275977 small insertion probably benign
P0007:Med12l UTSW 3 59091395 splice site probably benign
P0045:Med12l UTSW 3 59091535 missense probably damaging 0.99
R0030:Med12l UTSW 3 59248655 missense probably damaging 1.00
R0030:Med12l UTSW 3 59248655 missense probably damaging 1.00
R0148:Med12l UTSW 3 59037654 missense probably damaging 1.00
R0325:Med12l UTSW 3 59077059 missense possibly damaging 0.88
R0330:Med12l UTSW 3 59227702 missense probably damaging 1.00
R0388:Med12l UTSW 3 59093504 splice site probably benign
R0542:Med12l UTSW 3 59042401 missense probably damaging 1.00
R0624:Med12l UTSW 3 59037702 nonsense probably null
R0625:Med12l UTSW 3 59247437 missense probably damaging 1.00
R0671:Med12l UTSW 3 59264929 missense probably damaging 1.00
R0706:Med12l UTSW 3 59261980 missense probably damaging 1.00
R0785:Med12l UTSW 3 59260832 missense probably damaging 1.00
R1054:Med12l UTSW 3 59248651 missense probably damaging 0.99
R1102:Med12l UTSW 3 59244836 missense probably damaging 0.99
R1391:Med12l UTSW 3 59037738 missense probably benign 0.00
R1501:Med12l UTSW 3 59260835 critical splice donor site probably null
R1544:Med12l UTSW 3 59265240 missense possibly damaging 0.71
R1662:Med12l UTSW 3 59093617 missense probably damaging 1.00
R1670:Med12l UTSW 3 59275958 small insertion probably benign
R1839:Med12l UTSW 3 59068319 missense probably benign
R1854:Med12l UTSW 3 59260772 missense probably damaging 1.00
R2045:Med12l UTSW 3 59262310 nonsense probably null
R2070:Med12l UTSW 3 59244905 missense probably damaging 1.00
R2132:Med12l UTSW 3 59265282 unclassified probably null
R2290:Med12l UTSW 3 59244938 missense probably damaging 1.00
R2325:Med12l UTSW 3 59232454 missense probably damaging 0.99
R2352:Med12l UTSW 3 59240692 missense probably damaging 1.00
R2484:Med12l UTSW 3 59297838 missense probably benign 0.18
R2906:Med12l UTSW 3 59257082 missense probably damaging 1.00
R3736:Med12l UTSW 3 59091495 missense probably damaging 1.00
R3774:Med12l UTSW 3 59247942 missense probably damaging 0.97
R3957:Med12l UTSW 3 59073168 missense probably damaging 0.99
R4020:Med12l UTSW 3 59247942 missense probably damaging 0.97
R4087:Med12l UTSW 3 59297921 missense probably benign 0.00
R4231:Med12l UTSW 3 59257223 splice site probably null
R4233:Med12l UTSW 3 59257223 splice site probably null
R4235:Med12l UTSW 3 59257223 splice site probably null
R4236:Med12l UTSW 3 59257223 splice site probably null
R4327:Med12l UTSW 3 59265267 missense probably benign 0.01
R4328:Med12l UTSW 3 59265267 missense probably benign 0.01
R4346:Med12l UTSW 3 59031555 missense probably damaging 1.00
R4543:Med12l UTSW 3 59091508 missense probably damaging 1.00
R4559:Med12l UTSW 3 59007102 critical splice donor site probably null
R4776:Med12l UTSW 3 59233212 missense probably damaging 1.00
R4877:Med12l UTSW 3 59244793 missense probably damaging 1.00
R4983:Med12l UTSW 3 59261929 missense probably damaging 1.00
R5114:Med12l UTSW 3 59259688 missense possibly damaging 0.85
R5125:Med12l UTSW 3 59267214 missense possibly damaging 0.83
R5230:Med12l UTSW 3 59245788 missense probably damaging 1.00
R5407:Med12l UTSW 3 59258201 missense probably damaging 1.00
R5426:Med12l UTSW 3 59248722 missense probably damaging 0.98
R5439:Med12l UTSW 3 59263213 missense probably null 1.00
R5449:Med12l UTSW 3 59259706 missense probably damaging 1.00
R5596:Med12l UTSW 3 59252350 missense probably benign 0.45
R5716:Med12l UTSW 3 59301377 critical splice donor site probably null
R5833:Med12l UTSW 3 59265226 missense possibly damaging 0.95
R5883:Med12l UTSW 3 59091468 missense probably damaging 1.00
R6264:Med12l UTSW 3 59256002 missense probably damaging 1.00
R6269:Med12l UTSW 3 59227822 missense probably damaging 1.00
R6394:Med12l UTSW 3 59235087 missense probably damaging 1.00
R6400:Med12l UTSW 3 59247911 missense probably damaging 1.00
R6475:Med12l UTSW 3 59257079 missense probably damaging 1.00
R6489:Med12l UTSW 3 59257407 missense probably damaging 0.99
R6654:Med12l UTSW 3 59262292 missense probably damaging 1.00
R6881:Med12l UTSW 3 59267165 missense probably benign 0.00
R7110:Med12l UTSW 3 59262224 missense possibly damaging 0.92
R7134:Med12l UTSW 3 59093759 nonsense probably null
R7137:Med12l UTSW 3 59258254 missense probably damaging 1.00
X0062:Med12l UTSW 3 59233179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTAGTGAAAATGTACTTAGTCCTTG -3'
(R):5'- TGCCCATCTGAAACTGACTCC -3'

Sequencing Primer
(F):5'- TGTTTCTCACCTAGCGGA -3'
(R):5'- CCCCCAGTGGAGTTTACTTGG -3'
Posted On2015-03-18