Incidental Mutation 'R3735:1700001C02Rik'
List |< first << previous [record 49 of 55675] next >> last >|
ID270052
Institutional Source Beutler Lab
Gene Symbol 1700001C02Rik
Ensembl Gene ENSMUSG00000029182
Gene NameRIKEN cDNA 1700001C02 gene
Synonyms
MMRRC Submission 040722-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R3735 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location30466047-30484088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30482098 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 123 (Y123F)
Ref Sequence ENSEMBL: ENSMUSP00000031078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031078] [ENSMUST00000065486] [ENSMUST00000114743] [ENSMUST00000127815] [ENSMUST00000199129]
Predicted Effect probably benign
Transcript: ENSMUST00000031078
AA Change: Y123F

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000031078
Gene: ENSMUSG00000029182
AA Change: Y123F

DomainStartEndE-ValueType
Pfam:DUF2475 19 84 2.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065486
SMART Domains Protein: ENSMUSP00000066222
Gene: ENSMUSG00000053194

DomainStartEndE-ValueType
EFh 101 129 6.31e-1 SMART
EFh 143 171 2.22e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114743
AA Change: I138F
SMART Domains Protein: ENSMUSP00000110391
Gene: ENSMUSG00000029182
AA Change: I138F

DomainStartEndE-ValueType
Pfam:DUF2475 19 84 1e-26 PFAM
low complexity region 125 137 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127815
SMART Domains Protein: ENSMUSP00000142635
Gene: ENSMUSG00000029182

DomainStartEndE-ValueType
Pfam:DUF2475 19 84 5.6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199129
SMART Domains Protein: ENSMUSP00000142583
Gene: ENSMUSG00000029182

DomainStartEndE-ValueType
Pfam:DUF2475 19 84 3.7e-23 PFAM
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C G 4: 103,266,406 E90Q probably damaging Het
Acadl G A 1: 66,853,289 A125V probably benign Het
Acot12 T A 13: 91,784,346 I487N probably benign Het
Acox3 A G 5: 35,611,153 K686R probably benign Het
Adam17 T C 12: 21,325,412 D802G probably benign Het
Aoc3 A T 11: 101,332,219 D427V probably damaging Het
Bivm C T 1: 44,126,434 H15Y probably benign Het
C8a T C 4: 104,817,615 E509G probably benign Het
Ccdc158 A C 5: 92,632,424 L930R possibly damaging Het
Cdca7 T A 2: 72,483,865 probably null Het
Cep170b A T 12: 112,741,004 I395F probably damaging Het
Champ1 T C 8: 13,878,735 S298P probably damaging Het
Cyp2j8 T A 4: 96,444,599 R503S probably damaging Het
Dcaf10 C T 4: 45,348,117 T191I probably benign Het
Dido1 A G 2: 180,684,036 probably benign Het
Dnah7b C T 1: 46,299,875 T3361I probably benign Het
Dync1h1 G A 12: 110,631,675 V1767I probably benign Het
Eml5 G A 12: 98,855,989 T721I possibly damaging Het
F8 G A X: 75,211,375 P2138S probably damaging Het
Fam169b G T 7: 68,350,301 R198S probably damaging Het
Gm7694 A G 1: 170,302,761 S23P probably damaging Het
Grk3 T A 5: 112,953,831 T248S probably benign Het
Helq T G 5: 100,790,188 D464A possibly damaging Het
Ido2 C T 8: 24,535,193 V273M probably damaging Het
Il12rb1 T C 8: 70,817,218 L518P probably damaging Het
Kansl1l A G 1: 66,801,250 V297A possibly damaging Het
Kcnj10 A G 1: 172,369,966 Y349C possibly damaging Het
Krt18 A G 15: 102,028,501 T75A probably benign Het
Lrmp G A 6: 145,160,870 probably benign Het
Lrp4 A T 2: 91,498,371 I1539F probably damaging Het
Map3k6 T C 4: 133,246,372 V458A probably benign Het
Med12l T A 3: 59,091,495 H614Q probably damaging Het
Med13 A C 11: 86,279,658 M1850R probably benign Het
Mfsd13a A G 19: 46,368,328 Y256C probably damaging Het
Mogs C A 6: 83,116,776 T242K possibly damaging Het
Myo9b T C 8: 71,348,597 V1133A probably benign Het
Myom2 A T 8: 15,069,676 H144L probably benign Het
Ncapg A T 5: 45,696,127 Q906L probably benign Het
Nkx1-1 C T 5: 33,433,730 V83I unknown Het
Npy4r T A 14: 34,147,269 T21S probably benign Het
Nup88 A G 11: 70,956,192 S331P probably damaging Het
Olfr1294 T A 2: 111,537,896 H131L probably damaging Het
Olr1 T A 6: 129,499,875 probably benign Het
Osmr A T 15: 6,822,080 Y656N probably damaging Het
Otogl A T 10: 107,899,529 Y131* probably null Het
Pgr G A 9: 8,901,533 G356S probably damaging Het
Prdm2 T C 4: 143,134,359 E787G probably damaging Het
Prpf18 A G 2: 4,643,673 I114T probably benign Het
R3hdm2 T A 10: 127,465,010 I280N probably benign Het
Rims4 T C 2: 163,863,985 D243G possibly damaging Het
Rmnd5a T C 6: 71,396,862 D316G possibly damaging Het
Rpap2 T C 5: 107,655,151 probably benign Het
Sdr16c5 G A 4: 4,005,614 T240I probably benign Het
Shroom3 T C 5: 92,964,444 V1888A possibly damaging Het
Slc36a4 T A 9: 15,738,273 Y466* probably null Het
Slco3a1 A G 7: 74,504,497 I80T probably damaging Het
Sptlc2 G A 12: 87,341,565 A381V probably benign Het
Stam A T 2: 14,129,012 Q190L probably damaging Het
Suclg2 T A 6: 95,497,696 I363F probably damaging Het
Tacstd2 A G 6: 67,534,859 V283A probably damaging Het
Tln1 G T 4: 43,549,370 A616E probably damaging Het
Trdmt1 A T 2: 13,519,873 F257Y possibly damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,814,790 probably null Het
Trps1 A G 15: 50,846,060 I298T possibly damaging Het
Tti2 T C 8: 31,155,897 L413P probably damaging Het
Utrn A G 10: 12,478,484 V343A probably damaging Het
Vwf G T 6: 125,588,613 W288L probably damaging Het
Zfp629 T A 7: 127,612,778 probably benign Het
Zfp873 G A 10: 82,061,181 S582N probably benign Het
Zfp979 A G 4: 147,613,482 Y257H possibly damaging Het
Zfpm1 G A 8: 122,323,736 C117Y possibly damaging Het
Other mutations in 1700001C02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1284:1700001C02Rik UTSW 5 30480507 missense probably damaging 1.00
R1285:1700001C02Rik UTSW 5 30480507 missense probably damaging 1.00
R1286:1700001C02Rik UTSW 5 30480507 missense probably damaging 1.00
R1287:1700001C02Rik UTSW 5 30480507 missense probably damaging 1.00
R1699:1700001C02Rik UTSW 5 30483866 critical splice acceptor site probably null
R2109:1700001C02Rik UTSW 5 30480507 missense probably damaging 1.00
R3736:1700001C02Rik UTSW 5 30482098 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GACTTCTTAGCAGCCTGGTC -3'
(R):5'- CTGTTTCTCAGGGTCATGGCTC -3'

Sequencing Primer
(F):5'- CTGCATCAAAACTGCTGTGTG -3'
(R):5'- TCATGGCTCCAGGGCTG -3'
Posted On2015-03-18