Incidental Mutation 'R3735:Il12rb1'
ID270074
Institutional Source Beutler Lab
Gene Symbol Il12rb1
Ensembl Gene ENSMUSG00000000791
Gene Nameinterleukin 12 receptor, beta 1
SynonymsIL-12R[b], CD212
MMRRC Submission 040722-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R3735 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location70808449-70821424 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70817218 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 518 (L518P)
Ref Sequence ENSEMBL: ENSMUSP00000000808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000808] [ENSMUST00000212657]
Predicted Effect probably damaging
Transcript: ENSMUST00000000808
AA Change: L518P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000000808
Gene: ENSMUSG00000000791
AA Change: L518P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
FN3 467 550 9.4e-7 SMART
transmembrane domain 567 589 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212251
Predicted Effect probably damaging
Transcript: ENSMUST00000212657
AA Change: L518P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212826
Meta Mutation Damage Score 0.0304 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane protein that belongs to the hemopoietin receptor superfamily. This protein binds to interleukine 12 (IL12) with a low affinity, and is thought to be a part of IL12 receptor complex. This protein forms a disulfide-linked oligomer, which is required for its IL12 binding activity. The coexpression of this and IL12RB2 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. Mutations in this gene impair the development of interleukin-17-producing T lymphocytes and result in increased susceptibility to mycobacterial and Salmonella infections. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased serum IFN-gamma levels in response to recombinant IL-12 or LPS treatment, and failure of ConA-activated splenocytes to proliferate or secrete IFN-gamma in response to IL-12. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A T 5: 30,482,098 Y123F probably benign Het
4921539E11Rik C G 4: 103,266,406 E90Q probably damaging Het
Acadl G A 1: 66,853,289 A125V probably benign Het
Acot12 T A 13: 91,784,346 I487N probably benign Het
Acox3 A G 5: 35,611,153 K686R probably benign Het
Adam17 T C 12: 21,325,412 D802G probably benign Het
Aoc3 A T 11: 101,332,219 D427V probably damaging Het
Bivm C T 1: 44,126,434 H15Y probably benign Het
C8a T C 4: 104,817,615 E509G probably benign Het
Ccdc158 A C 5: 92,632,424 L930R possibly damaging Het
Cdca7 T A 2: 72,483,865 probably null Het
Cep170b A T 12: 112,741,004 I395F probably damaging Het
Champ1 T C 8: 13,878,735 S298P probably damaging Het
Cyp2j8 T A 4: 96,444,599 R503S probably damaging Het
Dcaf10 C T 4: 45,348,117 T191I probably benign Het
Dido1 A G 2: 180,684,036 probably benign Het
Dnah7b C T 1: 46,299,875 T3361I probably benign Het
Dync1h1 G A 12: 110,631,675 V1767I probably benign Het
Eml5 G A 12: 98,855,989 T721I possibly damaging Het
F8 G A X: 75,211,375 P2138S probably damaging Het
Fam169b G T 7: 68,350,301 R198S probably damaging Het
Gm7694 A G 1: 170,302,761 S23P probably damaging Het
Grk3 T A 5: 112,953,831 T248S probably benign Het
Helq T G 5: 100,790,188 D464A possibly damaging Het
Ido2 C T 8: 24,535,193 V273M probably damaging Het
Kansl1l A G 1: 66,801,250 V297A possibly damaging Het
Kcnj10 A G 1: 172,369,966 Y349C possibly damaging Het
Krt18 A G 15: 102,028,501 T75A probably benign Het
Lrmp G A 6: 145,160,870 probably benign Het
Lrp4 A T 2: 91,498,371 I1539F probably damaging Het
Map3k6 T C 4: 133,246,372 V458A probably benign Het
Med12l T A 3: 59,091,495 H614Q probably damaging Het
Med13 A C 11: 86,279,658 M1850R probably benign Het
Mfsd13a A G 19: 46,368,328 Y256C probably damaging Het
Mogs C A 6: 83,116,776 T242K possibly damaging Het
Myo9b T C 8: 71,348,597 V1133A probably benign Het
Myom2 A T 8: 15,069,676 H144L probably benign Het
Ncapg A T 5: 45,696,127 Q906L probably benign Het
Nkx1-1 C T 5: 33,433,730 V83I unknown Het
Npy4r T A 14: 34,147,269 T21S probably benign Het
Nup88 A G 11: 70,956,192 S331P probably damaging Het
Olfr1294 T A 2: 111,537,896 H131L probably damaging Het
Olr1 T A 6: 129,499,875 probably benign Het
Osmr A T 15: 6,822,080 Y656N probably damaging Het
Otogl A T 10: 107,899,529 Y131* probably null Het
Pgr G A 9: 8,901,533 G356S probably damaging Het
Prdm2 T C 4: 143,134,359 E787G probably damaging Het
Prpf18 A G 2: 4,643,673 I114T probably benign Het
R3hdm2 T A 10: 127,465,010 I280N probably benign Het
Rims4 T C 2: 163,863,985 D243G possibly damaging Het
Rmnd5a T C 6: 71,396,862 D316G possibly damaging Het
Rpap2 T C 5: 107,655,151 probably benign Het
Sdr16c5 G A 4: 4,005,614 T240I probably benign Het
Shroom3 T C 5: 92,964,444 V1888A possibly damaging Het
Slc36a4 T A 9: 15,738,273 Y466* probably null Het
Slco3a1 A G 7: 74,504,497 I80T probably damaging Het
Sptlc2 G A 12: 87,341,565 A381V probably benign Het
Stam A T 2: 14,129,012 Q190L probably damaging Het
Suclg2 T A 6: 95,497,696 I363F probably damaging Het
Tacstd2 A G 6: 67,534,859 V283A probably damaging Het
Tln1 G T 4: 43,549,370 A616E probably damaging Het
Trdmt1 A T 2: 13,519,873 F257Y possibly damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,814,790 probably null Het
Trps1 A G 15: 50,846,060 I298T possibly damaging Het
Tti2 T C 8: 31,155,897 L413P probably damaging Het
Utrn A G 10: 12,478,484 V343A probably damaging Het
Vwf G T 6: 125,588,613 W288L probably damaging Het
Zfp629 T A 7: 127,612,778 probably benign Het
Zfp873 G A 10: 82,061,181 S582N probably benign Het
Zfp979 A G 4: 147,613,482 Y257H possibly damaging Het
Zfpm1 G A 8: 122,323,736 C117Y possibly damaging Het
Other mutations in Il12rb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02056:Il12rb1 APN 8 70811187 nonsense probably null
IGL03065:Il12rb1 APN 8 70820558 missense possibly damaging 0.51
P0026:Il12rb1 UTSW 8 70812541 missense probably damaging 0.99
R0140:Il12rb1 UTSW 8 70819771 splice site probably benign
R0763:Il12rb1 UTSW 8 70813290 splice site probably benign
R1554:Il12rb1 UTSW 8 70813372 critical splice donor site probably null
R1577:Il12rb1 UTSW 8 70810606 missense probably damaging 0.99
R1688:Il12rb1 UTSW 8 70819402 missense probably damaging 1.00
R1918:Il12rb1 UTSW 8 70813680 missense probably benign 0.04
R2848:Il12rb1 UTSW 8 70815802 nonsense probably null
R4791:Il12rb1 UTSW 8 70813368 missense possibly damaging 0.83
R4857:Il12rb1 UTSW 8 70810588 missense possibly damaging 0.94
R5189:Il12rb1 UTSW 8 70811058 missense possibly damaging 0.66
R5493:Il12rb1 UTSW 8 70809839 missense probably benign 0.00
R5590:Il12rb1 UTSW 8 70813767 missense possibly damaging 0.83
R6484:Il12rb1 UTSW 8 70809704 unclassified probably null
R7213:Il12rb1 UTSW 8 70816453 missense probably benign 0.00
R7301:Il12rb1 UTSW 8 70813699 missense possibly damaging 0.73
R7388:Il12rb1 UTSW 8 70810627 missense probably damaging 1.00
X0061:Il12rb1 UTSW 8 70814635 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAATACGTCGTGCGCTG -3'
(R):5'- TCATTAGGGGAAGAGCAGTCAG -3'

Sequencing Primer
(F):5'- GCTGCGAGGCTGAAGAC -3'
(R):5'- GCAGTCAGCTATCCTTGATGTC -3'
Posted On2015-03-18