Incidental Mutation 'R3736:1700001C02Rik'
List |< first << previous [record 50 of 55675] next >> last >|
ID270112
Institutional Source Beutler Lab
Gene Symbol 1700001C02Rik
Ensembl Gene ENSMUSG00000029182
Gene NameRIKEN cDNA 1700001C02 gene
Synonyms
MMRRC Submission 040723-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R3736 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location30466047-30484088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30482098 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 123 (Y123F)
Ref Sequence ENSEMBL: ENSMUSP00000031078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031078] [ENSMUST00000065486] [ENSMUST00000114743] [ENSMUST00000127815] [ENSMUST00000199129]
Predicted Effect probably benign
Transcript: ENSMUST00000031078
AA Change: Y123F

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000031078
Gene: ENSMUSG00000029182
AA Change: Y123F

DomainStartEndE-ValueType
Pfam:DUF2475 19 84 2.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065486
SMART Domains Protein: ENSMUSP00000066222
Gene: ENSMUSG00000053194

DomainStartEndE-ValueType
EFh 101 129 6.31e-1 SMART
EFh 143 171 2.22e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114743
AA Change: I138F
SMART Domains Protein: ENSMUSP00000110391
Gene: ENSMUSG00000029182
AA Change: I138F

DomainStartEndE-ValueType
Pfam:DUF2475 19 84 1e-26 PFAM
low complexity region 125 137 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127815
SMART Domains Protein: ENSMUSP00000142635
Gene: ENSMUSG00000029182

DomainStartEndE-ValueType
Pfam:DUF2475 19 84 5.6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199129
SMART Domains Protein: ENSMUSP00000142583
Gene: ENSMUSG00000029182

DomainStartEndE-ValueType
Pfam:DUF2475 19 84 3.7e-23 PFAM
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik G A 7: 29,574,571 noncoding transcript Het
Acot12 T A 13: 91,784,346 I487N probably benign Het
Acox3 A G 5: 35,611,153 K686R probably benign Het
Adgrf2 T C 17: 42,711,012 E307G probably benign Het
Ang2 G A 14: 51,195,656 R90* probably null Het
Ankrd11 A T 8: 122,891,785 V1776D probably damaging Het
Atp12a G A 14: 56,374,427 V353I possibly damaging Het
Bbs7 A G 3: 36,607,670 Y127H possibly damaging Het
C8a T C 4: 104,817,615 E509G probably benign Het
Ccdc158 A C 5: 92,632,424 L930R possibly damaging Het
Ccdc162 T C 10: 41,589,568 probably null Het
Cep170b A T 12: 112,741,004 I395F probably damaging Het
Clcn3 T A 8: 60,983,652 probably benign Het
Ctps T C 4: 120,543,746 T459A probably benign Het
Cyp2j8 T A 4: 96,444,599 R503S probably damaging Het
Dync1h1 G A 12: 110,631,675 V1767I probably benign Het
Evi5 A T 5: 107,818,983 V224D probably damaging Het
F8 G A X: 75,211,375 P2138S probably damaging Het
Helq T G 5: 100,790,188 D464A possibly damaging Het
Kcnk10 A G 12: 98,489,912 V203A probably benign Het
Lef1 C T 3: 131,191,066 P160S possibly damaging Het
Lrmp G A 6: 145,160,870 probably benign Het
Lyn G T 4: 3,745,330 W78C probably damaging Het
Med12l T A 3: 59,091,495 H614Q probably damaging Het
Mogs C A 6: 83,116,776 T242K possibly damaging Het
Morc3 T A 16: 93,874,812 V910E probably damaging Het
Mrvi1 A G 7: 110,923,963 V297A probably benign Het
Ncapg A T 5: 45,696,127 Q906L probably benign Het
Nup210l A G 3: 90,120,013 Y234C probably damaging Het
Olfr502 A G 7: 108,523,419 V177A possibly damaging Het
Olr1 T A 6: 129,499,875 probably benign Het
Osmr A T 15: 6,822,080 Y656N probably damaging Het
Pde4dip A T 3: 97,724,111 F1161I probably damaging Het
Poc5 A G 13: 96,396,816 S151G probably damaging Het
Rmnd5a T C 6: 71,396,862 D316G possibly damaging Het
Shroom3 T C 5: 92,964,444 V1888A possibly damaging Het
Shtn1 A T 19: 59,022,268 S256T probably benign Het
Sptlc2 G A 12: 87,341,565 A381V probably benign Het
Suclg2 T A 6: 95,497,696 I363F probably damaging Het
Tas2r134 C A 2: 51,627,774 N88K probably damaging Het
Tbc1d32 A G 10: 56,129,093 Y815H probably damaging Het
Tnrc6b G C 15: 80,889,163 probably benign Het
Vti1a T A 19: 55,380,932 probably null Het
Zfp273 T A 13: 67,825,507 C251* probably null Het
Zfp683 C A 4: 134,057,431 Q330K probably benign Het
Zfpm1 G A 8: 122,323,736 C117Y possibly damaging Het
Zscan4d T C 7: 11,162,876 N189S probably benign Het
Other mutations in 1700001C02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1284:1700001C02Rik UTSW 5 30480507 missense probably damaging 1.00
R1285:1700001C02Rik UTSW 5 30480507 missense probably damaging 1.00
R1286:1700001C02Rik UTSW 5 30480507 missense probably damaging 1.00
R1287:1700001C02Rik UTSW 5 30480507 missense probably damaging 1.00
R1699:1700001C02Rik UTSW 5 30483866 critical splice acceptor site probably null
R2109:1700001C02Rik UTSW 5 30480507 missense probably damaging 1.00
R3735:1700001C02Rik UTSW 5 30482098 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTTACTCTCTGCATCAAAACTGCTG -3'
(R):5'- GCACCACTGGCTGTGTTAAC -3'

Sequencing Primer
(F):5'- CTGCATCAAAACTGCTGTGTGATG -3'
(R):5'- TTCTCAGGGTCATGGCTCCAG -3'
Posted On2015-03-18