Mutagenetix > Incidental Mutation

Incidental Mutation 'R3736:4930432E11Rik'

270124

Institutional Source

Beutler Lab

Gene Symbol

4930432E11Rik

Ensembl Gene

ENSMUSG00000046958

Gene Name

RIKEN cDNA 4930432E11 gene

Synonyms

MMRRC Submission

040723-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R3736 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29255998-29276204 bp(+) (GRCm39)

Type of Mutation

unclassified

DNA Base Change (assembly)

G to A at 29273996 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000053635

SMART Domains

Protein: ENSMUSP00000049518
Gene: ENSMUSG00000046958

Domain	Start	End	E-Value	Type
Blast:WD40	43	79	3e-11	BLAST
WD40	131	172	1.97e2	SMART
WD40	175	214	2.24e-2	SMART
Blast:WD40	257	296	4e-15	BLAST
WD40	393	437	1.32e2	SMART
WD40	494	533	2.15e-4	SMART
low complexity region	598	617	N/A	INTRINSIC
low complexity region	1082	1094	N/A	INTRINSIC
low complexity region	1107	1148	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000063585

SMART Domains

Protein: ENSMUSP00000063695
Gene: ENSMUSG00000051976

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
internal_repeat_1	35	67	3.29e-5	PROSPERO
internal_repeat_1	73	102	3.29e-5	PROSPERO
low complexity region	122	135	N/A	INTRINSIC
coiled coil region	161	182	N/A	INTRINSIC
low complexity region	216	233	N/A	INTRINSIC
low complexity region	239	249	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187265

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (53/53)

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot12	T	A	13: 91,932,465 (GRCm39)	I487N	probably benign	Het
Acox3	A	G	5: 35,768,497 (GRCm39)	K686R	probably benign	Het
Adgrf2	T	C	17: 43,021,903 (GRCm39)	E307G	probably benign	Het
Ang2	G	A	14: 51,433,113 (GRCm39)	R90*	probably null	Het
Ankrd11	A	T	8: 123,618,524 (GRCm39)	V1776D	probably damaging	Het
Atp12a	G	A	14: 56,611,884 (GRCm39)	V353I	possibly damaging	Het
Bbs7	A	G	3: 36,661,819 (GRCm39)	Y127H	possibly damaging	Het
C8a	T	C	4: 104,674,812 (GRCm39)	E509G	probably benign	Het
Ccdc158	A	C	5: 92,780,283 (GRCm39)	L930R	possibly damaging	Het
Ccdc162	T	C	10: 41,465,564 (GRCm39)		probably null	Het
Cep170b	A	T	12: 112,707,438 (GRCm39)	I395F	probably damaging	Het
Cimip2c	A	T	5: 30,639,442 (GRCm39)	Y123F	probably benign	Het
Clcn3	T	A	8: 61,436,686 (GRCm39)		probably benign	Het
Ctps1	T	C	4: 120,400,943 (GRCm39)	T459A	probably benign	Het
Cyp2j8	T	A	4: 96,332,836 (GRCm39)	R503S	probably damaging	Het
Dync1h1	G	A	12: 110,598,109 (GRCm39)	V1767I	probably benign	Het
Evi5	A	T	5: 107,966,849 (GRCm39)	V224D	probably damaging	Het
F8	G	A	X: 74,254,981 (GRCm39)	P2138S	probably damaging	Het
Helq	T	G	5: 100,938,054 (GRCm39)	D464A	possibly damaging	Het
Irag1	A	G	7: 110,523,170 (GRCm39)	V297A	probably benign	Het
Irag2	G	A	6: 145,106,596 (GRCm39)		probably benign	Het
Kcnk10	A	G	12: 98,456,171 (GRCm39)	V203A	probably benign	Het
Lef1	C	T	3: 130,984,715 (GRCm39)	P160S	possibly damaging	Het
Lyn	G	T	4: 3,745,330 (GRCm39)	W78C	probably damaging	Het
Med12l	T	A	3: 58,998,916 (GRCm39)	H614Q	probably damaging	Het
Mogs	C	A	6: 83,093,757 (GRCm39)	T242K	possibly damaging	Het
Morc3	T	A	16: 93,671,700 (GRCm39)	V910E	probably damaging	Het
Ncapg	A	T	5: 45,853,469 (GRCm39)	Q906L	probably benign	Het
Nup210l	A	G	3: 90,027,320 (GRCm39)	Y234C	probably damaging	Het
Olr1	T	A	6: 129,476,838 (GRCm39)		probably benign	Het
Or5p76	A	G	7: 108,122,626 (GRCm39)	V177A	possibly damaging	Het
Osmr	A	T	15: 6,851,561 (GRCm39)	Y656N	probably damaging	Het
Pde4dip	A	T	3: 97,631,427 (GRCm39)	F1161I	probably damaging	Het
Poc5	A	G	13: 96,533,324 (GRCm39)	S151G	probably damaging	Het
Rmnd5a	T	C	6: 71,373,846 (GRCm39)	D316G	possibly damaging	Het
Shroom3	T	C	5: 93,112,303 (GRCm39)	V1888A	possibly damaging	Het
Shtn1	A	T	19: 59,010,700 (GRCm39)	S256T	probably benign	Het
Sptlc2	G	A	12: 87,388,339 (GRCm39)	A381V	probably benign	Het
Suclg2	T	A	6: 95,474,677 (GRCm39)	I363F	probably damaging	Het
Tas2r134	C	A	2: 51,517,786 (GRCm39)	N88K	probably damaging	Het
Tbc1d32	A	G	10: 56,005,189 (GRCm39)	Y815H	probably damaging	Het
Tnrc6b	G	C	15: 80,773,364 (GRCm39)		probably benign	Het
Vti1a	T	A	19: 55,369,364 (GRCm39)		probably null	Het
Zfp273	T	A	13: 67,973,626 (GRCm39)	C251*	probably null	Het
Zfp683	C	A	4: 133,784,742 (GRCm39)	Q330K	probably benign	Het
Zfpm1	G	A	8: 123,050,475 (GRCm39)	C117Y	possibly damaging	Het
Zscan4d	T	C	7: 10,896,803 (GRCm39)	N189S	probably benign	Het

Other mutations in 4930432E11Rik

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL01121:4930432E11Rik	APN	7	29,273,426 (GRCm39)	unclassified	noncoding transcript
IGL01955:4930432E11Rik	APN	7	29,273,420 (GRCm39)	unclassified	noncoding transcript
IGL01971:4930432E11Rik	APN	7	29,273,987 (GRCm39)	unclassified	noncoding transcript
IGL02132:4930432E11Rik	APN	7	29,262,704 (GRCm39)	unclassified	noncoding transcript
IGL02484:4930432E11Rik	APN	7	29,262,777 (GRCm39)	unclassified	noncoding transcript
P0016:4930432E11Rik	UTSW	7	29,262,537 (GRCm39)	unclassified	noncoding transcript
R0051:4930432E11Rik	UTSW	7	29,278,526 (GRCm39)	exon	noncoding transcript
R0060:4930432E11Rik	UTSW	7	29,273,595 (GRCm39)	unclassified	noncoding transcript
R0094:4930432E11Rik	UTSW	7	29,260,236 (GRCm39)	exon	noncoding transcript
R0268:4930432E11Rik	UTSW	7	29,274,027 (GRCm39)	unclassified	noncoding transcript
R0423:4930432E11Rik	UTSW	7	29,261,825 (GRCm39)	exon	noncoding transcript
R0478:4930432E11Rik	UTSW	7	29,262,014 (GRCm39)	exon	noncoding transcript
R0646:4930432E11Rik	UTSW	7	29,260,710 (GRCm39)	exon	noncoding transcript
R1208:4930432E11Rik	UTSW	7	29,260,708 (GRCm39)	exon	noncoding transcript
R1778:4930432E11Rik	UTSW	7	29,260,131 (GRCm39)	exon	noncoding transcript
R1779:4930432E11Rik	UTSW	7	29,278,591 (GRCm39)	exon	noncoding transcript
R1918:4930432E11Rik	UTSW	7	29,273,514 (GRCm39)	unclassified	noncoding transcript
R2360:4930432E11Rik	UTSW	7	29,274,214 (GRCm39)	unclassified	noncoding transcript
R3780:4930432E11Rik	UTSW	7	29,260,263 (GRCm39)	exon	noncoding transcript
R4427:4930432E11Rik	UTSW	7	29,278,678 (GRCm39)	exon	noncoding transcript
R4835:4930432E11Rik	UTSW	7	29,274,326 (GRCm39)	unclassified	noncoding transcript
R4929:4930432E11Rik	UTSW	7	29,273,467 (GRCm39)	unclassified	noncoding transcript
R5042:4930432E11Rik	UTSW	7	29,273,927 (GRCm39)	unclassified	noncoding transcript
R5129:4930432E11Rik	UTSW	7	29,260,786 (GRCm39)	exon	noncoding transcript
R5371:4930432E11Rik	UTSW	7	29,261,918 (GRCm39)	exon	noncoding transcript
R5381:4930432E11Rik	UTSW	7	29,262,393 (GRCm39)	unclassified	noncoding transcript
R5586:4930432E11Rik	UTSW	7	29,277,153 (GRCm39)	unclassified	noncoding transcript
R5874:4930432E11Rik	UTSW	7	29,280,610 (GRCm39)	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- AACGCATCAGTCCTCTCTGC -3'
(R):5'- AAGATCTCTTCAGCTCCCAGGG -3'

Sequencing Primer
(F):5'- TCTGCCTTAGTAGCTCTACTTAAAG -3'
(R):5'- AGCTCCCAGGGCCTCTTTG -3'

Posted On

2015-03-18