Incidental Mutation 'R3736:Zfpm1'
ID270128
Institutional Source Beutler Lab
Gene Symbol Zfpm1
Ensembl Gene ENSMUSG00000049577
Gene Namezinc finger protein, multitype 1
SynonymsFog1, Friend of GATA-1
MMRRC Submission 040723-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.767) question?
Stock #R3736 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location122282141-122337251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122323736 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 117 (C117Y)
Ref Sequence ENSEMBL: ENSMUSP00000058037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054052] [ENSMUST00000127664]
PDB Structure
Solution structure of the third zinc finger domain of FOG-1 [SOLUTION NMR]
Solution structure of the PR domain of FOG-1 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054052
AA Change: C117Y

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058037
Gene: ENSMUSG00000049577
AA Change: C117Y

DomainStartEndE-ValueType
low complexity region 32 72 N/A INTRINSIC
low complexity region 86 94 N/A INTRINSIC
ZnF_C2H2 255 275 3.13e1 SMART
ZnF_C2H2 303 327 1.69e-3 SMART
ZnF_C2H2 333 355 1.53e-1 SMART
ZnF_C2H2 361 384 9.46e0 SMART
low complexity region 508 525 N/A INTRINSIC
low complexity region 570 578 N/A INTRINSIC
ZnF_C2H2 590 610 1.41e2 SMART
low complexity region 626 643 N/A INTRINSIC
low complexity region 644 663 N/A INTRINSIC
ZnF_C2H2 696 723 1.78e2 SMART
low complexity region 725 755 N/A INTRINSIC
low complexity region 761 779 N/A INTRINSIC
low complexity region 785 806 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
ZnF_C2H2 836 856 7.77e1 SMART
ZnF_C2H2 868 891 1.96e1 SMART
low complexity region 948 961 N/A INTRINSIC
ZnF_C2H2 963 989 4.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176883
Meta Mutation Damage Score 0.0552 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Homozygous mutants have poorly vascularized yolk sacs and small, pale livers. Mutants die between embryonic days 10.5 and 12.5 with severe anemia associated with a block in megakaryocyte development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A T 5: 30,482,098 Y123F probably benign Het
4930432E11Rik G A 7: 29,574,571 noncoding transcript Het
Acot12 T A 13: 91,784,346 I487N probably benign Het
Acox3 A G 5: 35,611,153 K686R probably benign Het
Adgrf2 T C 17: 42,711,012 E307G probably benign Het
Ang2 G A 14: 51,195,656 R90* probably null Het
Ankrd11 A T 8: 122,891,785 V1776D probably damaging Het
Atp12a G A 14: 56,374,427 V353I possibly damaging Het
Bbs7 A G 3: 36,607,670 Y127H possibly damaging Het
C8a T C 4: 104,817,615 E509G probably benign Het
Ccdc158 A C 5: 92,632,424 L930R possibly damaging Het
Ccdc162 T C 10: 41,589,568 probably null Het
Cep170b A T 12: 112,741,004 I395F probably damaging Het
Clcn3 T A 8: 60,983,652 probably benign Het
Ctps T C 4: 120,543,746 T459A probably benign Het
Cyp2j8 T A 4: 96,444,599 R503S probably damaging Het
Dync1h1 G A 12: 110,631,675 V1767I probably benign Het
Evi5 A T 5: 107,818,983 V224D probably damaging Het
F8 G A X: 75,211,375 P2138S probably damaging Het
Helq T G 5: 100,790,188 D464A possibly damaging Het
Kcnk10 A G 12: 98,489,912 V203A probably benign Het
Lef1 C T 3: 131,191,066 P160S possibly damaging Het
Lrmp G A 6: 145,160,870 probably benign Het
Lyn G T 4: 3,745,330 W78C probably damaging Het
Med12l T A 3: 59,091,495 H614Q probably damaging Het
Mogs C A 6: 83,116,776 T242K possibly damaging Het
Morc3 T A 16: 93,874,812 V910E probably damaging Het
Mrvi1 A G 7: 110,923,963 V297A probably benign Het
Ncapg A T 5: 45,696,127 Q906L probably benign Het
Nup210l A G 3: 90,120,013 Y234C probably damaging Het
Olfr502 A G 7: 108,523,419 V177A possibly damaging Het
Olr1 T A 6: 129,499,875 probably benign Het
Osmr A T 15: 6,822,080 Y656N probably damaging Het
Pde4dip A T 3: 97,724,111 F1161I probably damaging Het
Poc5 A G 13: 96,396,816 S151G probably damaging Het
Rmnd5a T C 6: 71,396,862 D316G possibly damaging Het
Shroom3 T C 5: 92,964,444 V1888A possibly damaging Het
Shtn1 A T 19: 59,022,268 S256T probably benign Het
Sptlc2 G A 12: 87,341,565 A381V probably benign Het
Suclg2 T A 6: 95,497,696 I363F probably damaging Het
Tas2r134 C A 2: 51,627,774 N88K probably damaging Het
Tbc1d32 A G 10: 56,129,093 Y815H probably damaging Het
Tnrc6b G C 15: 80,889,163 probably benign Het
Vti1a T A 19: 55,380,932 probably null Het
Zfp273 T A 13: 67,825,507 C251* probably null Het
Zfp683 C A 4: 134,057,431 Q330K probably benign Het
Zscan4d T C 7: 11,162,876 N189S probably benign Het
Other mutations in Zfpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02540:Zfpm1 APN 8 122332120 missense possibly damaging 0.65
R0006:Zfpm1 UTSW 8 122334488 missense probably damaging 1.00
R0508:Zfpm1 UTSW 8 122335133 missense probably damaging 1.00
R0631:Zfpm1 UTSW 8 122336874 intron probably benign
R0729:Zfpm1 UTSW 8 122336659 missense probably benign 0.20
R0883:Zfpm1 UTSW 8 122335846 missense probably damaging 0.99
R1469:Zfpm1 UTSW 8 122335846 missense probably damaging 0.99
R1469:Zfpm1 UTSW 8 122335846 missense probably damaging 0.99
R1509:Zfpm1 UTSW 8 122307546 missense possibly damaging 0.63
R1938:Zfpm1 UTSW 8 122334924 splice site probably null
R2060:Zfpm1 UTSW 8 122336592 missense probably benign 0.37
R3735:Zfpm1 UTSW 8 122323736 missense possibly damaging 0.83
R4528:Zfpm1 UTSW 8 122335642 missense probably benign 0.06
R4735:Zfpm1 UTSW 8 122335480 missense probably benign 0.24
R4924:Zfpm1 UTSW 8 122334608 missense possibly damaging 0.95
R5347:Zfpm1 UTSW 8 122335530 missense possibly damaging 0.94
R5375:Zfpm1 UTSW 8 122336073 missense probably benign 0.00
R5470:Zfpm1 UTSW 8 122333793 missense probably damaging 0.99
R6358:Zfpm1 UTSW 8 122337111 intron probably benign
R6768:Zfpm1 UTSW 8 122334456 missense probably damaging 1.00
R6966:Zfpm1 UTSW 8 122332165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTGCAGACTGTGACCAAG -3'
(R):5'- CTACTCATTGCAGACGCTCC -3'

Sequencing Primer
(F):5'- GCAGACTGTGACCAAGCCATG -3'
(R):5'- AGACGCTCCCCAGGAAGTC -3'
Posted On2015-03-18