Incidental Mutation 'R3739:Gbp10'
ID270282
Institutional Source Beutler Lab
Gene Symbol Gbp10
Ensembl Gene ENSMUSG00000105096
Gene Nameguanylate-binding protein 10
Synonyms
MMRRC Submission 040725-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R3739 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location105215699-105239533 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105224458 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 145 (E145D)
Ref Sequence ENSEMBL: ENSMUSP00000069042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050011] [ENSMUST00000065588]
Predicted Effect probably benign
Transcript: ENSMUST00000050011
SMART Domains Protein: ENSMUSP00000062528
Gene: ENSMUSG00000079362

DomainStartEndE-ValueType
Pfam:GBP 16 279 7.6e-118 PFAM
Pfam:GBP_C 281 575 2.1e-117 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000065588
AA Change: E145D

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000069042
Gene: ENSMUSG00000105096
AA Change: E145D

DomainStartEndE-ValueType
Pfam:GBP 16 279 5e-115 PFAM
Pfam:GBP_C 281 575 3.6e-117 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196634
Meta Mutation Damage Score 0.0956 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 49,019,281 L775* probably null Het
Abcb8 A G 5: 24,400,621 S168G probably benign Het
Ahnak2 T C 12: 112,774,558 I1027V probably benign Het
Alox12e A G 11: 70,319,842 L318P probably damaging Het
Ankrd11 A G 8: 122,896,715 probably benign Het
Anks1b T A 10: 90,033,216 I46N probably damaging Het
Apoa5 G C 9: 46,269,117 W7S probably damaging Het
Arnt2 T C 7: 84,343,801 H177R probably null Het
Cacna1c T C 6: 118,741,952 D220G probably benign Het
Dst C T 1: 34,268,894 probably benign Het
Eml6 C A 11: 29,803,137 V925L probably benign Het
Fbll1 G A 11: 35,797,678 H253Y possibly damaging Het
Galnt1 A G 18: 24,271,655 T350A probably benign Het
Gfm1 T C 3: 67,456,700 I503T probably damaging Het
Hmcn2 A T 2: 31,336,612 K200* probably null Het
Ifi203 T A 1: 173,929,474 probably benign Het
Itgbl1 T C 14: 123,966,678 F394L probably damaging Het
Itpkc T A 7: 27,227,604 D295V possibly damaging Het
Klra17 T A 6: 129,873,365 I41F probably benign Het
Lcorl A T 5: 45,734,041 N323K possibly damaging Het
Ltbp2 A T 12: 84,804,474 C836S probably damaging Het
Mfsd2b A G 12: 4,870,578 S80P probably damaging Het
Ms4a18 A T 19: 11,011,499 H164Q probably damaging Het
Mybbp1a A G 11: 72,448,737 H882R possibly damaging Het
Myh9 G A 15: 77,766,812 R1612C probably damaging Het
Myo18a A G 11: 77,845,615 D1514G probably damaging Het
Nsun2 T C 13: 69,629,638 I441T probably benign Het
Ntng1 A T 3: 109,934,691 D255E probably damaging Het
Olfr1385 A G 11: 49,495,460 D309G possibly damaging Het
Osbpl2 G A 2: 180,161,560 R475H probably damaging Het
Pclo A C 5: 14,680,899 K3138N unknown Het
Pcsk7 A G 9: 45,926,759 T572A possibly damaging Het
Pex11a C T 7: 79,740,170 R56H possibly damaging Het
Pnmal2 C T 7: 16,946,596 H502Y probably benign Het
Saa4 T A 7: 46,729,629 N96Y possibly damaging Het
Serpinb6d T A 13: 33,667,680 V140E probably damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
St18 G A 1: 6,855,473 probably null Het
Taf3 T C 2: 9,951,658 E566G possibly damaging Het
Tnr T C 1: 159,923,413 S1315P possibly damaging Het
Trappc11 T C 8: 47,514,103 E412G probably damaging Het
Trpc2 G A 7: 102,084,504 S220N probably damaging Het
Trpm7 A G 2: 126,851,521 V48A probably damaging Het
Tubb6 A G 18: 67,402,051 Y340C probably damaging Het
Vmn1r197 C A 13: 22,328,576 Y222* probably null Het
Vmn2r97 T C 17: 18,928,151 S103P probably damaging Het
Zfp362 C G 4: 128,786,889 probably benign Het
Zfp423 A G 8: 87,781,344 C666R probably damaging Het
Other mutations in Gbp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01470:Gbp10 APN 5 105221114 splice site probably benign
IGL01680:Gbp10 APN 5 105224271 splice site probably null
IGL01809:Gbp10 APN 5 105217359 missense probably benign
IGL01845:Gbp10 APN 5 105219949 splice site probably null
IGL02011:Gbp10 APN 5 105221101 missense probably damaging 1.00
IGL02063:Gbp10 APN 5 105236040 missense possibly damaging 0.95
IGL02533:Gbp10 APN 5 105220035 missense probably damaging 1.00
IGL02612:Gbp10 APN 5 105218502 missense possibly damaging 0.88
R0349:Gbp10 UTSW 5 105221076 missense possibly damaging 0.60
R0462:Gbp10 UTSW 5 105218524 missense possibly damaging 0.67
R0535:Gbp10 UTSW 5 105221011 missense possibly damaging 0.95
R1223:Gbp10 UTSW 5 105219001 missense probably damaging 1.00
R1704:Gbp10 UTSW 5 105224351 missense probably damaging 1.00
R1792:Gbp10 UTSW 5 105224300 missense probably damaging 1.00
R3738:Gbp10 UTSW 5 105224458 missense possibly damaging 0.84
R4035:Gbp10 UTSW 5 105224458 missense possibly damaging 0.84
R4421:Gbp10 UTSW 5 105224651 splice site probably null
R5207:Gbp10 UTSW 5 105224709 missense probably benign 0.05
R5338:Gbp10 UTSW 5 105224300 missense probably damaging 1.00
R6010:Gbp10 UTSW 5 105224339 missense probably damaging 1.00
R6045:Gbp10 UTSW 5 105218403 missense probably damaging 0.98
R6156:Gbp10 UTSW 5 105236149 start gained probably benign
R6285:Gbp10 UTSW 5 105218460 missense probably damaging 1.00
R6525:Gbp10 UTSW 5 105236084 missense probably benign 0.01
R6908:Gbp10 UTSW 5 105221032 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCTTCAAGGCATTCTCCAGG -3'
(R):5'- TTCTGAGCAGCACCTTCATC -3'

Sequencing Primer
(F):5'- AAGGCATTCTCCAGGTAGTCATC -3'
(R):5'- GAGCAGCTGCAGTATCCTTCTG -3'
Posted On2015-03-18