Incidental Mutation 'R3739:Serpinb6d'
ID270309
Institutional Source Beutler Lab
Gene Symbol Serpinb6d
Ensembl Gene ENSMUSG00000047889
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 6d
SynonymsSPI3D, Gm11390
MMRRC Submission 040725-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R3739 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location33661405-33671581 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33667680 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 140 (V140E)
Ref Sequence ENSEMBL: ENSMUSP00000152621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059637] [ENSMUST00000221681]
Predicted Effect probably damaging
Transcript: ENSMUST00000059637
AA Change: V140E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063025
Gene: ENSMUSG00000047889
AA Change: V140E

DomainStartEndE-ValueType
SERPIN 13 375 1.67e-144 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000221681
AA Change: V140E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.546 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: This gene is a member of the large Serpin gene family. Many members of this family act as protease inhibitors, and have a conserved structure including a reactive center loop (RCL) that can act as a bait for protease targets. Unlike some members of this large gene family, the protein encoded by this gene is an intracellular protein, and lacks an N-terminal signal peptide sequence. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 13. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 49,019,281 L775* probably null Het
Abcb8 A G 5: 24,400,621 S168G probably benign Het
Ahnak2 T C 12: 112,774,558 I1027V probably benign Het
Alox12e A G 11: 70,319,842 L318P probably damaging Het
Ankrd11 A G 8: 122,896,715 probably benign Het
Anks1b T A 10: 90,033,216 I46N probably damaging Het
Apoa5 G C 9: 46,269,117 W7S probably damaging Het
Arnt2 T C 7: 84,343,801 H177R probably null Het
Cacna1c T C 6: 118,741,952 D220G probably benign Het
Dst C T 1: 34,268,894 probably benign Het
Eml6 C A 11: 29,803,137 V925L probably benign Het
Fbll1 G A 11: 35,797,678 H253Y possibly damaging Het
Galnt1 A G 18: 24,271,655 T350A probably benign Het
Gbp10 T A 5: 105,224,458 E145D possibly damaging Het
Gfm1 T C 3: 67,456,700 I503T probably damaging Het
Hmcn2 A T 2: 31,336,612 K200* probably null Het
Ifi203 T A 1: 173,929,474 probably benign Het
Itgbl1 T C 14: 123,966,678 F394L probably damaging Het
Itpkc T A 7: 27,227,604 D295V possibly damaging Het
Klra17 T A 6: 129,873,365 I41F probably benign Het
Lcorl A T 5: 45,734,041 N323K possibly damaging Het
Ltbp2 A T 12: 84,804,474 C836S probably damaging Het
Mfsd2b A G 12: 4,870,578 S80P probably damaging Het
Ms4a18 A T 19: 11,011,499 H164Q probably damaging Het
Mybbp1a A G 11: 72,448,737 H882R possibly damaging Het
Myh9 G A 15: 77,766,812 R1612C probably damaging Het
Myo18a A G 11: 77,845,615 D1514G probably damaging Het
Nsun2 T C 13: 69,629,638 I441T probably benign Het
Ntng1 A T 3: 109,934,691 D255E probably damaging Het
Olfr1385 A G 11: 49,495,460 D309G possibly damaging Het
Osbpl2 G A 2: 180,161,560 R475H probably damaging Het
Pclo A C 5: 14,680,899 K3138N unknown Het
Pcsk7 A G 9: 45,926,759 T572A possibly damaging Het
Pex11a C T 7: 79,740,170 R56H possibly damaging Het
Pnmal2 C T 7: 16,946,596 H502Y probably benign Het
Saa4 T A 7: 46,729,629 N96Y possibly damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
St18 G A 1: 6,855,473 probably null Het
Taf3 T C 2: 9,951,658 E566G possibly damaging Het
Tnr T C 1: 159,923,413 S1315P possibly damaging Het
Trappc11 T C 8: 47,514,103 E412G probably damaging Het
Trpc2 G A 7: 102,084,504 S220N probably damaging Het
Trpm7 A G 2: 126,851,521 V48A probably damaging Het
Tubb6 A G 18: 67,402,051 Y340C probably damaging Het
Vmn1r197 C A 13: 22,328,576 Y222* probably null Het
Vmn2r97 T C 17: 18,928,151 S103P probably damaging Het
Zfp362 C G 4: 128,786,889 probably benign Het
Zfp423 A G 8: 87,781,344 C666R probably damaging Het
Other mutations in Serpinb6d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Serpinb6d APN 13 33671363 missense probably benign 0.05
IGL01611:Serpinb6d APN 13 33666392 nonsense probably null
IGL01946:Serpinb6d APN 13 33671386 missense probably benign 0.22
IGL02672:Serpinb6d APN 13 33671389 missense probably benign 0.36
R0041:Serpinb6d UTSW 13 33667632 missense probably damaging 0.98
R0041:Serpinb6d UTSW 13 33667632 missense probably damaging 0.98
R1112:Serpinb6d UTSW 13 33669135 missense probably damaging 1.00
R1159:Serpinb6d UTSW 13 33671229 missense probably damaging 0.98
R1447:Serpinb6d UTSW 13 33670756 missense probably benign 0.42
R1608:Serpinb6d UTSW 13 33669129 missense probably benign
R1843:Serpinb6d UTSW 13 33671381 missense probably benign
R1945:Serpinb6d UTSW 13 33667680 missense possibly damaging 0.95
R2168:Serpinb6d UTSW 13 33666374 missense probably benign 0.08
R2275:Serpinb6d UTSW 13 33671428 missense probably benign 0.00
R3737:Serpinb6d UTSW 13 33667680 missense probably damaging 1.00
R3738:Serpinb6d UTSW 13 33667680 missense probably damaging 1.00
R3780:Serpinb6d UTSW 13 33664114 missense probably benign
R3782:Serpinb6d UTSW 13 33664114 missense probably benign
R4002:Serpinb6d UTSW 13 33670647 missense probably damaging 0.98
R4685:Serpinb6d UTSW 13 33671228 missense probably damaging 1.00
R4707:Serpinb6d UTSW 13 33671353 missense possibly damaging 0.83
R4761:Serpinb6d UTSW 13 33671267 missense probably damaging 1.00
R4859:Serpinb6d UTSW 13 33667564 intron probably null
R4884:Serpinb6d UTSW 13 33666445 missense possibly damaging 0.76
R4951:Serpinb6d UTSW 13 33666383 missense probably benign 0.03
R5010:Serpinb6d UTSW 13 33671444 missense probably benign 0.15
R5081:Serpinb6d UTSW 13 33671247 missense probably benign 0.32
R6726:Serpinb6d UTSW 13 33670735 missense probably benign 0.01
R6960:Serpinb6d UTSW 13 33671198 missense probably benign 0.08
R7214:Serpinb6d UTSW 13 33664145 missense probably damaging 1.00
Z1088:Serpinb6d UTSW 13 33671254 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TTTCCGTGCATAGGAAAGGAG -3'
(R):5'- AACTCTTGTGTGTTGTCCTGAC -3'

Sequencing Primer
(F):5'- AGGAGCCTGTTGGTGCTAAAC -3'
(R):5'- ACTCTTGTGTGTTGTCCTGACTATAG -3'
Posted On2015-03-18