Incidental Mutation 'R3739:Vmn2r97'
ID270314
Institutional Source Beutler Lab
Gene Symbol Vmn2r97
Ensembl Gene ENSMUSG00000091491
Gene Namevomeronasal 2, receptor 97
SynonymsEG627367
MMRRC Submission 040725-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R3739 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location18914300-18958087 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18928151 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 103 (S103P)
Ref Sequence ENSEMBL: ENSMUSP00000156141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168710] [ENSMUST00000232219]
Predicted Effect probably damaging
Transcript: ENSMUST00000168710
AA Change: S103P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129313
Gene: ENSMUSG00000091491
AA Change: S103P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 82 442 2.9e-36 PFAM
Pfam:NCD3G 513 566 4.9e-21 PFAM
Pfam:7tm_3 599 834 1.7e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000232219
AA Change: S103P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232325
Meta Mutation Damage Score 0.0252 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 49,019,281 L775* probably null Het
Abcb8 A G 5: 24,400,621 S168G probably benign Het
Ahnak2 T C 12: 112,774,558 I1027V probably benign Het
Alox12e A G 11: 70,319,842 L318P probably damaging Het
Ankrd11 A G 8: 122,896,715 probably benign Het
Anks1b T A 10: 90,033,216 I46N probably damaging Het
Apoa5 G C 9: 46,269,117 W7S probably damaging Het
Arnt2 T C 7: 84,343,801 H177R probably null Het
Cacna1c T C 6: 118,741,952 D220G probably benign Het
Dst C T 1: 34,268,894 probably benign Het
Eml6 C A 11: 29,803,137 V925L probably benign Het
Fbll1 G A 11: 35,797,678 H253Y possibly damaging Het
Galnt1 A G 18: 24,271,655 T350A probably benign Het
Gbp10 T A 5: 105,224,458 E145D possibly damaging Het
Gfm1 T C 3: 67,456,700 I503T probably damaging Het
Hmcn2 A T 2: 31,336,612 K200* probably null Het
Ifi203 T A 1: 173,929,474 probably benign Het
Itgbl1 T C 14: 123,966,678 F394L probably damaging Het
Itpkc T A 7: 27,227,604 D295V possibly damaging Het
Klra17 T A 6: 129,873,365 I41F probably benign Het
Lcorl A T 5: 45,734,041 N323K possibly damaging Het
Ltbp2 A T 12: 84,804,474 C836S probably damaging Het
Mfsd2b A G 12: 4,870,578 S80P probably damaging Het
Ms4a18 A T 19: 11,011,499 H164Q probably damaging Het
Mybbp1a A G 11: 72,448,737 H882R possibly damaging Het
Myh9 G A 15: 77,766,812 R1612C probably damaging Het
Myo18a A G 11: 77,845,615 D1514G probably damaging Het
Nsun2 T C 13: 69,629,638 I441T probably benign Het
Ntng1 A T 3: 109,934,691 D255E probably damaging Het
Olfr1385 A G 11: 49,495,460 D309G possibly damaging Het
Osbpl2 G A 2: 180,161,560 R475H probably damaging Het
Pclo A C 5: 14,680,899 K3138N unknown Het
Pcsk7 A G 9: 45,926,759 T572A possibly damaging Het
Pex11a C T 7: 79,740,170 R56H possibly damaging Het
Pnmal2 C T 7: 16,946,596 H502Y probably benign Het
Saa4 T A 7: 46,729,629 N96Y possibly damaging Het
Serpinb6d T A 13: 33,667,680 V140E probably damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
St18 G A 1: 6,855,473 probably null Het
Taf3 T C 2: 9,951,658 E566G possibly damaging Het
Tnr T C 1: 159,923,413 S1315P possibly damaging Het
Trappc11 T C 8: 47,514,103 E412G probably damaging Het
Trpc2 G A 7: 102,084,504 S220N probably damaging Het
Trpm7 A G 2: 126,851,521 V48A probably damaging Het
Tubb6 A G 18: 67,402,051 Y340C probably damaging Het
Vmn1r197 C A 13: 22,328,576 Y222* probably null Het
Zfp362 C G 4: 128,786,889 probably benign Het
Zfp423 A G 8: 87,781,344 C666R probably damaging Het
Other mutations in Vmn2r97
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r97 APN 17 18947659 missense probably benign 0.37
IGL00962:Vmn2r97 APN 17 18929228 missense probably damaging 1.00
IGL01704:Vmn2r97 APN 17 18947811 missense probably damaging 0.99
IGL01888:Vmn2r97 APN 17 18929024 nonsense probably null
IGL02429:Vmn2r97 APN 17 18930334 missense possibly damaging 0.94
IGL02742:Vmn2r97 APN 17 18929170 missense probably damaging 0.97
IGL02934:Vmn2r97 APN 17 18929685 missense probably benign 0.00
IGL02978:Vmn2r97 APN 17 18948036 missense probably benign 0.01
IGL03230:Vmn2r97 APN 17 18929406 missense probably benign 0.10
IGL03241:Vmn2r97 APN 17 18928176 missense probably benign 0.11
IGL03050:Vmn2r97 UTSW 17 18947638 missense possibly damaging 0.84
PIT4469001:Vmn2r97 UTSW 17 18929616 missense probably benign 0.00
R0482:Vmn2r97 UTSW 17 18947668 missense probably damaging 1.00
R0514:Vmn2r97 UTSW 17 18914472 missense probably benign 0.25
R0944:Vmn2r97 UTSW 17 18947403 missense probably benign 0.13
R1061:Vmn2r97 UTSW 17 18928178 nonsense probably null
R1546:Vmn2r97 UTSW 17 18947848 missense probably damaging 1.00
R1725:Vmn2r97 UTSW 17 18929135 missense probably benign 0.43
R1860:Vmn2r97 UTSW 17 18947386 missense probably benign 0.01
R1938:Vmn2r97 UTSW 17 18929331 missense probably benign 0.01
R1944:Vmn2r97 UTSW 17 18940238 missense probably benign 0.00
R2027:Vmn2r97 UTSW 17 18929682 missense unknown
R2106:Vmn2r97 UTSW 17 18947838 missense probably damaging 1.00
R2151:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2153:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2154:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2516:Vmn2r97 UTSW 17 18947552 missense probably benign
R3744:Vmn2r97 UTSW 17 18929628 missense probably benign
R3885:Vmn2r97 UTSW 17 18928334 missense possibly damaging 0.90
R3899:Vmn2r97 UTSW 17 18947611 missense probably damaging 0.96
R4115:Vmn2r97 UTSW 17 18928070 missense probably benign 0.01
R4247:Vmn2r97 UTSW 17 18947280 missense possibly damaging 0.83
R4287:Vmn2r97 UTSW 17 18948075 intron probably benign
R4439:Vmn2r97 UTSW 17 18930354 missense probably benign 0.00
R4523:Vmn2r97 UTSW 17 18929071 missense probably benign 0.03
R4783:Vmn2r97 UTSW 17 18929288 missense probably benign
R4948:Vmn2r97 UTSW 17 18947299 missense possibly damaging 0.95
R4981:Vmn2r97 UTSW 17 18940174 nonsense probably null
R5029:Vmn2r97 UTSW 17 18947911 missense probably damaging 1.00
R5200:Vmn2r97 UTSW 17 18928353 missense probably damaging 1.00
R5541:Vmn2r97 UTSW 17 18928355 nonsense probably null
R5637:Vmn2r97 UTSW 17 18947366 nonsense probably null
R5765:Vmn2r97 UTSW 17 18947180 nonsense probably null
R5885:Vmn2r97 UTSW 17 18947773 missense possibly damaging 0.50
R6272:Vmn2r97 UTSW 17 18947599 missense possibly damaging 0.70
R6553:Vmn2r97 UTSW 17 18930304 nonsense probably null
R6818:Vmn2r97 UTSW 17 18947931 missense possibly damaging 0.95
R6880:Vmn2r97 UTSW 17 18914508 missense probably benign 0.00
R7012:Vmn2r97 UTSW 17 18947494 missense probably damaging 0.99
R7023:Vmn2r97 UTSW 17 18914401 missense probably damaging 1.00
R7044:Vmn2r97 UTSW 17 18914367 missense probably benign 0.05
R7191:Vmn2r97 UTSW 17 18930286 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTTAATCTGTTCATGAAAAGGC -3'
(R):5'- GTTGAAGCAATGTCCCAATTTG -3'

Sequencing Primer
(F):5'- TGCCACTTAAACAGGTATAAC -3'
(R):5'- CCAATTTGGGCAGATGTTATCC -3'
Posted On2015-03-18