Incidental Mutation 'R3740:Kif5a'
ID270343
Institutional Source Beutler Lab
Gene Symbol Kif5a
Ensembl Gene ENSMUSG00000074657
Gene Namekinesin family member 5A
SynonymsKhc, Kns, Kif5, D10Bwg0738e
MMRRC Submission 040726-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3740 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127225696-127263348 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127243468 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 287 (I287T)
Ref Sequence ENSEMBL: ENSMUSP00000151402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099172] [ENSMUST00000217895] [ENSMUST00000218298]
Predicted Effect probably damaging
Transcript: ENSMUST00000099172
AA Change: I287T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096775
Gene: ENSMUSG00000074657
AA Change: I287T

DomainStartEndE-ValueType
KISc 7 335 7.38e-173 SMART
low complexity region 340 362 N/A INTRINSIC
coiled coil region 408 539 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
coiled coil region 632 800 N/A INTRINSIC
coiled coil region 822 905 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217895
AA Change: I287T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000218298
Meta Mutation Damage Score 0.462 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 94% (29/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of proteins. Members of this family are part of a multisubunit complex that functions as a microtubule motor in intracellular organelle transport. Mutations in this gene cause autosomal dominant spastic paraplegia 10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes complete neonatal lethality. Homozygotes delivered by caesarian section are alive at E18.5 but usually die within minutes after birth, exhibiting an abnormal breathing pattern, atelectasis, cyanosis, and abnormal motor neuron morphology in the spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,826,454 R103G probably benign Het
Atp8b2 C G 3: 89,946,031 A726P probably benign Het
Bbox1 A G 2: 110,305,577 I19T possibly damaging Het
Ctso G A 3: 81,952,249 V288I probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fam135a A T 1: 24,014,811 M1215K probably damaging Het
Fam174b T C 7: 73,740,830 probably null Het
Fgfr1op2 A G 6: 146,595,233 I190V possibly damaging Het
Flt1 G A 5: 147,599,593 R813W probably damaging Het
Gm6489 T A 1: 31,287,683 noncoding transcript Het
Hacd3 T C 9: 65,021,473 E24G possibly damaging Het
Kat6b T G 14: 21,670,044 M1488R probably damaging Het
Kcnk3 T C 5: 30,621,930 V108A possibly damaging Het
Mical1 A C 10: 41,479,071 D192A probably benign Het
Mov10l1 A G 15: 89,012,142 N678D possibly damaging Het
Nup210l A T 3: 90,207,394 M1759L probably benign Het
Optn C A 2: 5,034,198 M371I possibly damaging Het
Pik3cg T C 12: 32,205,224 K255E probably damaging Het
Rims1 A T 1: 22,373,443 V380D probably damaging Het
Serpinb6e T A 13: 33,838,960 I147F probably benign Het
Slc13a1 T C 6: 24,134,477 M136V probably damaging Het
Syngr4 T C 7: 45,895,770 E5G possibly damaging Het
Tiam2 A G 17: 3,414,113 D39G possibly damaging Het
Tmem88b A G 4: 155,785,427 L59P probably damaging Het
Ttn T A 2: 76,790,359 K13995* probably null Het
Vmn1r225 A G 17: 20,502,999 Q234R possibly damaging Het
Vmn2r107 A G 17: 20,374,889 N568S probably benign Het
Zfp605 G T 5: 110,128,698 G561W probably damaging Het
Zfp69 T A 4: 120,930,874 probably null Het
Other mutations in Kif5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Kif5a APN 10 127239196 missense probably benign
IGL01405:Kif5a APN 10 127245990 missense probably damaging 1.00
IGL01637:Kif5a APN 10 127245368 missense possibly damaging 0.94
IGL01894:Kif5a APN 10 127262779 missense probably benign 0.04
IGL01978:Kif5a APN 10 127245739 missense probably benign
IGL02039:Kif5a APN 10 127233867 missense possibly damaging 0.95
IGL02052:Kif5a APN 10 127243499 missense probably damaging 1.00
IGL02336:Kif5a APN 10 127242696 missense possibly damaging 0.87
IGL02352:Kif5a APN 10 127243501 missense probably damaging 1.00
IGL02359:Kif5a APN 10 127243501 missense probably damaging 1.00
IGL02834:Kif5a APN 10 127245756 missense probably benign 0.00
IGL03101:Kif5a APN 10 127235609 unclassified probably benign
R0463:Kif5a UTSW 10 127235652 missense probably benign 0.00
R0790:Kif5a UTSW 10 127246009 intron probably benign
R1070:Kif5a UTSW 10 127245406 missense probably benign 0.00
R1404:Kif5a UTSW 10 127245442 missense probably benign 0.12
R1404:Kif5a UTSW 10 127245442 missense probably benign 0.12
R1502:Kif5a UTSW 10 127245441 missense probably damaging 1.00
R1812:Kif5a UTSW 10 127242010 missense probably benign 0.03
R1837:Kif5a UTSW 10 127236815 nonsense probably null
R1838:Kif5a UTSW 10 127236815 nonsense probably null
R2012:Kif5a UTSW 10 127239175 missense probably benign
R2072:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2073:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2074:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2075:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2440:Kif5a UTSW 10 127231336 missense probably benign 0.34
R3157:Kif5a UTSW 10 127245441 missense probably damaging 1.00
R3688:Kif5a UTSW 10 127242774 missense probably damaging 1.00
R4782:Kif5a UTSW 10 127230954 missense probably benign 0.01
R5049:Kif5a UTSW 10 127239839 missense possibly damaging 0.93
R5723:Kif5a UTSW 10 127231029 frame shift probably null
R5764:Kif5a UTSW 10 127231029 frame shift probably null
R5838:Kif5a UTSW 10 127245441 missense probably damaging 1.00
R5903:Kif5a UTSW 10 127230578 missense probably benign 0.00
R6299:Kif5a UTSW 10 127233821 missense probably damaging 1.00
R6384:Kif5a UTSW 10 127242775 missense probably damaging 1.00
R6629:Kif5a UTSW 10 127248254 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTATGTGTGCCCATGTGTG -3'
(R):5'- AACGTGATCTCTGCACTGGC -3'

Sequencing Primer
(F):5'- GCCCATGTGTGTGTCTGCC -3'
(R):5'- ACCGTGAGTGTCCCCTG -3'
Posted On2015-03-18