Incidental Mutation 'R3741:Myo1a'
ID270372
Institutional Source Beutler Lab
Gene Symbol Myo1a
Ensembl Gene ENSMUSG00000025401
Gene Namemyosin IA
Synonymsbrush border myosin 1, BBM-I, Myhl
MMRRC Submission 040727-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R3741 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127705170-127720940 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127714898 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 593 (D593G)
Ref Sequence ENSEMBL: ENSMUSP00000078540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079590]
Predicted Effect probably benign
Transcript: ENSMUST00000079590
AA Change: D593G

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000078540
Gene: ENSMUSG00000025401
AA Change: D593G

DomainStartEndE-ValueType
MYSc 3 695 N/A SMART
IQ 696 718 1.27e-3 SMART
IQ 719 741 1.09e-2 SMART
IQ 742 764 7.52e-6 SMART
Pfam:Myosin_TH1 847 1035 1.4e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219882
Meta Mutation Damage Score 0.1088 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional skeletal muscle myosin-1 (MYH1). Unconventional myosins contain the basic domains characteristic of conventional myosins and are further distinguished from class members by their tail domains. They function as actin-based molecular motors. Mutations in this gene have been associated with autosomal dominant deafness. Alternatively spliced variants have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice display abnormal small intestine brush border morphology, but have normal hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,478,619 V1748A possibly damaging Het
Atp10b A T 11: 43,235,662 S1082C probably damaging Het
Atp8b2 C G 3: 89,946,031 A726P probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bbip1 T C 19: 53,932,175 M1V probably null Het
Bbox1 A G 2: 110,305,577 I19T possibly damaging Het
Bclaf3 T A X: 159,551,832 H41Q probably benign Het
Ctsm T A 13: 61,539,627 Q107L probably benign Het
Ctso G A 3: 81,952,249 V288I probably benign Het
Cyp2a4 A C 7: 26,308,544 K125N probably damaging Het
Dapk1 T C 13: 60,748,200 S701P probably benign Het
Dnah1 A G 14: 31,265,467 probably benign Het
Dnah11 A G 12: 118,131,341 M718T probably benign Het
Dnah2 C A 11: 69,448,469 A3071S probably damaging Het
Epb41l4a A T 18: 33,828,102 probably null Het
Fam135a A T 1: 24,014,811 M1215K probably damaging Het
Gm6489 T A 1: 31,287,683 noncoding transcript Het
Hhipl1 A G 12: 108,318,717 Y443C probably damaging Het
Hoxc13 G A 15: 102,921,438 G84D possibly damaging Het
Ifi207 T C 1: 173,727,562 I851M probably damaging Het
Lipk T G 19: 34,021,707 L134R probably damaging Het
Mov10l1 A G 15: 89,012,142 N678D possibly damaging Het
Msrb3 A T 10: 120,784,214 F67I probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup210l A T 3: 90,207,394 M1759L probably benign Het
Optn C A 2: 5,034,198 M371I possibly damaging Het
Rims1 A T 1: 22,373,443 V380D probably damaging Het
Rnf148 A G 6: 23,654,065 C311R possibly damaging Het
Rrp12 T C 19: 41,885,728 D377G probably damaging Het
Sbp T A 17: 23,945,582 probably benign Het
Sipa1 T C 19: 5,654,857 E570G probably damaging Het
Spem2 T C 11: 69,816,730 R470G possibly damaging Het
Syngr4 T C 7: 45,895,770 E5G possibly damaging Het
Tmem88b A G 4: 155,785,427 L59P probably damaging Het
Ttn T A 2: 76,790,359 K13995* probably null Het
Vmn1r69 A G 7: 10,580,142 Y221H possibly damaging Het
Zfp386 T A 12: 116,059,550 L296* probably null Het
Other mutations in Myo1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Myo1a APN 10 127720660 missense probably benign 0.00
IGL01896:Myo1a APN 10 127719904 missense probably benign
IGL02073:Myo1a APN 10 127710225 missense probably damaging 0.98
IGL02380:Myo1a APN 10 127714485 missense probably benign 0.00
IGL02507:Myo1a APN 10 127712609 missense probably damaging 0.98
R0106:Myo1a UTSW 10 127719880 missense probably benign 0.02
R0326:Myo1a UTSW 10 127716297 missense probably benign 0.00
R0357:Myo1a UTSW 10 127710902 missense probably benign 0.02
R0485:Myo1a UTSW 10 127719242 splice site probably benign
R0676:Myo1a UTSW 10 127719880 missense probably benign 0.02
R0707:Myo1a UTSW 10 127719863 unclassified probably benign
R1241:Myo1a UTSW 10 127719279 missense probably benign 0.00
R1441:Myo1a UTSW 10 127719279 missense probably benign 0.00
R1458:Myo1a UTSW 10 127719937 missense probably benign
R1546:Myo1a UTSW 10 127712624 missense probably damaging 1.00
R1692:Myo1a UTSW 10 127719334 synonymous probably null
R1871:Myo1a UTSW 10 127719671 missense probably benign
R2067:Myo1a UTSW 10 127705478 missense probably benign 0.25
R2079:Myo1a UTSW 10 127720613 missense probably benign 0.00
R2151:Myo1a UTSW 10 127720181 missense probably benign 0.18
R2375:Myo1a UTSW 10 127705290 missense probably damaging 1.00
R3014:Myo1a UTSW 10 127716345 missense probably damaging 1.00
R3812:Myo1a UTSW 10 127707415 missense possibly damaging 0.89
R4303:Myo1a UTSW 10 127713733 missense probably benign 0.10
R4306:Myo1a UTSW 10 127714081 missense probably benign
R4472:Myo1a UTSW 10 127710458 missense probably benign 0.06
R4599:Myo1a UTSW 10 127720151 unclassified probably null
R4604:Myo1a UTSW 10 127711138 missense probably damaging 1.00
R4649:Myo1a UTSW 10 127710217 missense probably benign 0.05
R4747:Myo1a UTSW 10 127714438 missense probably damaging 1.00
R4755:Myo1a UTSW 10 127715688 missense probably damaging 1.00
R4972:Myo1a UTSW 10 127716309 missense probably benign 0.31
R5072:Myo1a UTSW 10 127707419 critical splice donor site probably null
R5073:Myo1a UTSW 10 127707419 critical splice donor site probably null
R5074:Myo1a UTSW 10 127707419 critical splice donor site probably null
R5386:Myo1a UTSW 10 127705897 nonsense probably null
R5592:Myo1a UTSW 10 127714039 missense probably damaging 1.00
R5619:Myo1a UTSW 10 127718544 missense probably benign 0.00
R6001:Myo1a UTSW 10 127706925 critical splice donor site probably null
R6374:Myo1a UTSW 10 127707680 missense probably damaging 1.00
R6577:Myo1a UTSW 10 127715320 missense possibly damaging 0.94
R6932:Myo1a UTSW 10 127710458 missense probably benign 0.06
R7310:Myo1a UTSW 10 127705828 missense probably damaging 0.98
R7395:Myo1a UTSW 10 127710440 missense probably damaging 0.98
X0067:Myo1a UTSW 10 127713745 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGATGAGGAGTTGAGCATC -3'
(R):5'- ATCATCCCCATTCCAGCGAG -3'

Sequencing Primer
(F):5'- AGTTGAGCATCCAGTGGC -3'
(R):5'- ATTCCAGCGAGGCCAGGTG -3'
Posted On2015-03-18