Incidental Mutation 'R3743:Chd3'
ID 270458
Institutional Source Beutler Lab
Gene Symbol Chd3
Ensembl Gene ENSMUSG00000018474
Gene Name chromodomain helicase DNA binding protein 3
Synonyms 2600010P09Rik, Mi-2 alpha, Chd7, Prp7, Prp9-1
MMRRC Submission 040729-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3743 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 69234099-69260232 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 69254876 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 61 (R61*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092971] [ENSMUST00000108661] [ENSMUST00000144701] [ENSMUST00000154046]
AlphaFold B1AR17
Predicted Effect probably null
Transcript: ENSMUST00000092971
AA Change: R155*
SMART Domains Protein: ENSMUSP00000090649
Gene: ENSMUSG00000018474
AA Change: R155*

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 148 180 N/A INTRINSIC
Pfam:CHDNT 199 253 1.4e-34 PFAM
low complexity region 257 283 N/A INTRINSIC
low complexity region 285 308 N/A INTRINSIC
low complexity region 345 360 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
PHD 434 477 1.54e-14 SMART
RING 435 476 4.25e-1 SMART
PHD 510 553 1.74e-13 SMART
RING 511 552 3.93e0 SMART
CHROMO 558 637 7.23e-14 SMART
CHROMO 681 730 2.85e-12 SMART
low complexity region 749 755 N/A INTRINSIC
DEXDc 784 996 1.64e-31 SMART
low complexity region 1107 1125 N/A INTRINSIC
HELICc 1142 1226 2.61e-25 SMART
low complexity region 1290 1303 N/A INTRINSIC
DUF1087 1345 1409 2.98e-33 SMART
DUF1086 1415 1571 1.79e-109 SMART
low complexity region 1573 1602 N/A INTRINSIC
low complexity region 1672 1685 N/A INTRINSIC
Pfam:CHDCT2 1754 1926 8.6e-104 PFAM
low complexity region 1935 1967 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108661
AA Change: R155*
SMART Domains Protein: ENSMUSP00000104301
Gene: ENSMUSG00000018474
AA Change: R155*

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 148 180 N/A INTRINSIC
Pfam:CHDNT 200 253 4.3e-29 PFAM
low complexity region 257 283 N/A INTRINSIC
low complexity region 285 308 N/A INTRINSIC
low complexity region 345 360 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
PHD 434 477 1.54e-14 SMART
RING 435 476 4.25e-1 SMART
PHD 510 553 1.74e-13 SMART
RING 511 552 3.93e0 SMART
CHROMO 558 637 7.23e-14 SMART
CHROMO 681 730 2.85e-12 SMART
low complexity region 749 755 N/A INTRINSIC
DEXDc 784 996 1.64e-31 SMART
low complexity region 1107 1125 N/A INTRINSIC
HELICc 1142 1226 2.61e-25 SMART
low complexity region 1290 1303 N/A INTRINSIC
DUF1087 1345 1409 2.98e-33 SMART
DUF1086 1415 1571 1.79e-109 SMART
low complexity region 1573 1602 N/A INTRINSIC
low complexity region 1672 1685 N/A INTRINSIC
Pfam:CHDCT2 1789 1960 4.9e-93 PFAM
low complexity region 1969 2001 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000128981
AA Change: R61*
SMART Domains Protein: ENSMUSP00000122137
Gene: ENSMUSG00000018474
AA Change: R61*

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 55 87 N/A INTRINSIC
Pfam:CHDNT 107 160 3.9e-29 PFAM
low complexity region 164 190 N/A INTRINSIC
low complexity region 192 215 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
low complexity region 305 321 N/A INTRINSIC
PHD 341 384 1.54e-14 SMART
RING 342 383 4.25e-1 SMART
PHD 417 460 1.74e-13 SMART
RING 418 459 3.93e0 SMART
CHROMO 465 544 7.23e-14 SMART
CHROMO 588 637 2.85e-12 SMART
low complexity region 656 662 N/A INTRINSIC
DEXDc 691 903 1.64e-31 SMART
low complexity region 1014 1032 N/A INTRINSIC
HELICc 1049 1133 2.61e-25 SMART
low complexity region 1197 1210 N/A INTRINSIC
DUF1087 1252 1316 2.98e-33 SMART
DUF1086 1322 1478 1.79e-109 SMART
low complexity region 1480 1509 N/A INTRINSIC
low complexity region 1579 1592 N/A INTRINSIC
Pfam:CHDCT2 1662 1833 4.4e-93 PFAM
low complexity region 1842 1874 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144701
SMART Domains Protein: ENSMUSP00000114520
Gene: ENSMUSG00000018474

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 67 N/A INTRINSIC
PHD 84 127 1.54e-14 SMART
RING 85 126 4.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154046
SMART Domains Protein: ENSMUSP00000121192
Gene: ENSMUSG00000018474

DomainStartEndE-ValueType
low complexity region 1 29 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
PHD 86 129 1.54e-14 SMART
RING 87 128 4.25e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000166700
AA Change: R11H
SMART Domains Protein: ENSMUSP00000126782
Gene: ENSMUSG00000091095
AA Change: R11H

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
low complexity region 28 42 N/A INTRINSIC
low complexity region 79 101 N/A INTRINSIC
low complexity region 103 159 N/A INTRINSIC
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CHD family of proteins which are characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. This protein is one of the components of a histone deacetylase complex referred to as the Mi-2/NuRD complex which participates in the remodeling of chromatin by deacetylating histones. Chromatin remodeling is essential for many processes including transcription. Autoantibodies against this protein are found in a subset of patients with dermatomyositis. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A G 4: 137,182,348 (GRCm39) R168G probably damaging Het
1700030K09Rik A G 8: 73,199,013 (GRCm39) H140R probably benign Het
Adamts10 A G 17: 33,747,686 (GRCm39) I41V probably damaging Het
Arnt T C 3: 95,382,016 (GRCm39) V198A possibly damaging Het
Atg3 A G 16: 44,998,591 (GRCm39) probably null Het
Atmin T C 8: 117,683,312 (GRCm39) V324A probably benign Het
Ccdc88c G A 12: 100,914,843 (GRCm39) R464C probably damaging Het
Ccr7 G T 11: 99,036,033 (GRCm39) S296R possibly damaging Het
Cdh12 T A 15: 21,537,745 (GRCm39) S415R probably damaging Het
Cep162 A T 9: 87,099,230 (GRCm39) probably benign Het
Cr2 A G 1: 194,832,274 (GRCm39) probably benign Het
Csf1r T C 18: 61,247,846 (GRCm39) S305P probably benign Het
Cyp4a31 A C 4: 115,423,716 (GRCm39) Q140P possibly damaging Het
Dhx40 A T 11: 86,661,985 (GRCm39) W691R probably damaging Het
Dlgap1 G A 17: 71,025,221 (GRCm39) probably null Het
Entr1 A G 2: 26,278,655 (GRCm39) probably benign Het
Exoc5 T C 14: 49,251,806 (GRCm39) I582V probably benign Het
Exoc5 A T 14: 49,270,864 (GRCm39) L387* probably null Het
Fbxw8 A G 5: 118,251,704 (GRCm39) S270P probably damaging Het
Fgf14 C A 14: 124,914,032 (GRCm39) G33V probably benign Het
Hoxd9 T A 2: 74,528,710 (GRCm39) V104E probably damaging Het
Igsf10 T C 3: 59,233,546 (GRCm39) H1729R possibly damaging Het
Irf8 C T 8: 121,480,310 (GRCm39) R274C probably damaging Het
Itgb4 G A 11: 115,894,496 (GRCm39) M1350I probably damaging Het
Lrrn4 A G 2: 132,711,786 (GRCm39) probably null Het
Map3k6 C T 4: 132,972,384 (GRCm39) T320I probably benign Het
Morc2a A G 11: 3,633,700 (GRCm39) E604G possibly damaging Het
Mtmr6 T C 14: 60,537,747 (GRCm39) I582T probably benign Het
Ninl A G 2: 150,792,168 (GRCm39) V785A probably benign Het
Obscn T C 11: 58,969,911 (GRCm39) E77G probably damaging Het
Or2b11 T C 11: 59,462,335 (GRCm39) Y77C probably damaging Het
Or2n1 T G 17: 38,486,793 (GRCm39) F273V probably damaging Het
Or4f61 A G 2: 111,922,965 (GRCm39) L27P probably benign Het
Pcdhb2 A G 18: 37,429,470 (GRCm39) D124G probably damaging Het
Pfkl G A 10: 77,832,179 (GRCm39) T304M probably damaging Het
Ppil4 T A 10: 7,696,935 (GRCm39) S483T unknown Het
Slc7a10 C T 7: 34,898,325 (GRCm39) T332I probably damaging Het
Spats2 T C 15: 99,108,795 (GRCm39) S382P probably benign Het
Stpg1 T A 4: 135,242,197 (GRCm39) D70E probably benign Het
Tmprss11e G A 5: 86,857,315 (GRCm39) Q333* probably null Het
Trpv1 A T 11: 73,145,128 (GRCm39) D430V probably damaging Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,648 (GRCm39) probably benign Het
Zc3h6 A G 2: 128,839,712 (GRCm39) Y175C probably damaging Het
Other mutations in Chd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Chd3 APN 11 69,247,888 (GRCm39) missense probably damaging 0.96
IGL00551:Chd3 APN 11 69,237,455 (GRCm39) missense probably damaging 1.00
IGL00661:Chd3 APN 11 69,248,209 (GRCm39) missense possibly damaging 0.84
IGL00698:Chd3 APN 11 69,240,697 (GRCm39) missense probably damaging 0.98
IGL01075:Chd3 APN 11 69,250,791 (GRCm39) missense probably damaging 1.00
IGL01309:Chd3 APN 11 69,248,557 (GRCm39) missense probably damaging 0.99
IGL01317:Chd3 APN 11 69,244,037 (GRCm39) missense probably damaging 1.00
IGL01374:Chd3 APN 11 69,250,806 (GRCm39) missense probably damaging 0.99
IGL01444:Chd3 APN 11 69,239,568 (GRCm39) missense probably benign 0.28
IGL01617:Chd3 APN 11 69,249,060 (GRCm39) unclassified probably benign
IGL01635:Chd3 APN 11 69,252,076 (GRCm39) splice site probably benign
IGL01942:Chd3 APN 11 69,240,931 (GRCm39) critical splice donor site probably null
IGL01962:Chd3 APN 11 69,248,319 (GRCm39) missense possibly damaging 0.46
IGL01981:Chd3 APN 11 69,251,501 (GRCm39) missense probably damaging 0.99
IGL02022:Chd3 APN 11 69,251,886 (GRCm39) missense probably damaging 1.00
IGL02098:Chd3 APN 11 69,250,655 (GRCm39) missense probably damaging 1.00
IGL02218:Chd3 APN 11 69,242,920 (GRCm39) unclassified probably benign
IGL02415:Chd3 APN 11 69,239,739 (GRCm39) splice site probably benign
IGL02648:Chd3 APN 11 69,242,976 (GRCm39) missense probably damaging 1.00
IGL02951:Chd3 APN 11 69,251,874 (GRCm39) critical splice donor site probably null
IGL03030:Chd3 APN 11 69,245,230 (GRCm39) missense possibly damaging 0.64
IGL03102:Chd3 APN 11 69,252,022 (GRCm39) nonsense probably null
IGL03168:Chd3 APN 11 69,239,741 (GRCm39) splice site probably benign
IGL03327:Chd3 APN 11 69,241,012 (GRCm39) missense probably damaging 1.00
burg UTSW 11 69,247,380 (GRCm39) missense probably damaging 1.00
castello UTSW 11 69,246,648 (GRCm39) critical splice acceptor site probably benign
feste UTSW 11 69,245,252 (GRCm39) nonsense probably null
Fortress UTSW 11 69,254,876 (GRCm39) nonsense probably null
moat UTSW 11 69,250,011 (GRCm39) missense probably damaging 0.98
Redoubt UTSW 11 69,244,727 (GRCm39) unclassified probably benign
schloss UTSW 11 69,252,886 (GRCm39) nonsense probably null
siege UTSW 11 69,247,844 (GRCm39) missense probably damaging 1.00
R0009:Chd3 UTSW 11 69,240,732 (GRCm39) missense probably damaging 0.99
R0009:Chd3 UTSW 11 69,240,732 (GRCm39) missense probably damaging 0.99
R0056:Chd3 UTSW 11 69,250,739 (GRCm39) unclassified probably benign
R0129:Chd3 UTSW 11 69,239,327 (GRCm39) nonsense probably null
R0130:Chd3 UTSW 11 69,250,656 (GRCm39) missense probably damaging 1.00
R0309:Chd3 UTSW 11 69,247,844 (GRCm39) missense probably damaging 1.00
R0330:Chd3 UTSW 11 69,247,159 (GRCm39) missense probably damaging 1.00
R0449:Chd3 UTSW 11 69,248,367 (GRCm39) missense probably damaging 0.98
R0502:Chd3 UTSW 11 69,244,931 (GRCm39) missense probably damaging 0.98
R0540:Chd3 UTSW 11 69,235,184 (GRCm39) missense probably damaging 0.98
R0571:Chd3 UTSW 11 69,252,495 (GRCm39) critical splice donor site probably null
R0607:Chd3 UTSW 11 69,235,184 (GRCm39) missense probably damaging 0.98
R0616:Chd3 UTSW 11 69,236,313 (GRCm39) missense probably damaging 0.96
R0630:Chd3 UTSW 11 69,238,021 (GRCm39) missense probably damaging 1.00
R1436:Chd3 UTSW 11 69,248,400 (GRCm39) splice site probably null
R1484:Chd3 UTSW 11 69,250,725 (GRCm39) missense probably benign 0.17
R1741:Chd3 UTSW 11 69,246,480 (GRCm39) missense probably damaging 1.00
R1748:Chd3 UTSW 11 69,255,523 (GRCm39) missense possibly damaging 0.81
R1751:Chd3 UTSW 11 69,244,727 (GRCm39) unclassified probably benign
R1833:Chd3 UTSW 11 69,244,949 (GRCm39) missense probably damaging 1.00
R2012:Chd3 UTSW 11 69,239,878 (GRCm39) missense probably benign 0.01
R2101:Chd3 UTSW 11 69,239,877 (GRCm39) missense probably benign
R2147:Chd3 UTSW 11 69,239,854 (GRCm39) missense probably benign 0.00
R2513:Chd3 UTSW 11 69,251,471 (GRCm39) missense probably damaging 1.00
R2877:Chd3 UTSW 11 69,251,998 (GRCm39) nonsense probably null
R2879:Chd3 UTSW 11 69,254,924 (GRCm39) missense possibly damaging 0.52
R2880:Chd3 UTSW 11 69,242,946 (GRCm39) missense probably damaging 1.00
R2881:Chd3 UTSW 11 69,242,946 (GRCm39) missense probably damaging 1.00
R2973:Chd3 UTSW 11 69,251,442 (GRCm39) missense probably damaging 1.00
R3611:Chd3 UTSW 11 69,252,973 (GRCm39) missense possibly damaging 0.53
R3845:Chd3 UTSW 11 69,237,585 (GRCm39) missense possibly damaging 0.65
R3889:Chd3 UTSW 11 69,250,011 (GRCm39) missense probably damaging 0.98
R4007:Chd3 UTSW 11 69,239,827 (GRCm39) missense probably benign
R4115:Chd3 UTSW 11 69,248,343 (GRCm39) missense possibly damaging 0.95
R4515:Chd3 UTSW 11 69,240,703 (GRCm39) missense probably benign 0.00
R4612:Chd3 UTSW 11 69,244,035 (GRCm39) nonsense probably null
R4622:Chd3 UTSW 11 69,239,834 (GRCm39) missense probably damaging 0.98
R4634:Chd3 UTSW 11 69,253,013 (GRCm39) unclassified probably benign
R4635:Chd3 UTSW 11 69,253,013 (GRCm39) unclassified probably benign
R4859:Chd3 UTSW 11 69,250,722 (GRCm39) missense possibly damaging 0.79
R4930:Chd3 UTSW 11 69,245,034 (GRCm39) unclassified probably benign
R5173:Chd3 UTSW 11 69,260,069 (GRCm39) unclassified probably benign
R5287:Chd3 UTSW 11 69,239,895 (GRCm39) splice site probably null
R5403:Chd3 UTSW 11 69,239,895 (GRCm39) splice site probably null
R5511:Chd3 UTSW 11 69,252,301 (GRCm39) missense probably damaging 1.00
R5666:Chd3 UTSW 11 69,244,177 (GRCm39) missense possibly damaging 0.83
R5702:Chd3 UTSW 11 69,252,261 (GRCm39) missense possibly damaging 0.46
R6045:Chd3 UTSW 11 69,242,944 (GRCm39) missense possibly damaging 0.90
R6063:Chd3 UTSW 11 69,240,063 (GRCm39) missense probably benign
R6211:Chd3 UTSW 11 69,243,503 (GRCm39) missense probably damaging 1.00
R6215:Chd3 UTSW 11 69,247,380 (GRCm39) missense probably damaging 1.00
R6217:Chd3 UTSW 11 69,236,361 (GRCm39) missense probably damaging 1.00
R6302:Chd3 UTSW 11 69,244,604 (GRCm39) missense probably damaging 0.98
R6329:Chd3 UTSW 11 69,252,510 (GRCm39) missense possibly damaging 0.70
R6349:Chd3 UTSW 11 69,254,857 (GRCm39) missense possibly damaging 0.50
R6414:Chd3 UTSW 11 69,243,371 (GRCm39) critical splice donor site probably null
R6453:Chd3 UTSW 11 69,240,938 (GRCm39) nonsense probably null
R6548:Chd3 UTSW 11 69,252,886 (GRCm39) nonsense probably null
R6582:Chd3 UTSW 11 69,259,982 (GRCm39) unclassified probably benign
R6721:Chd3 UTSW 11 69,260,045 (GRCm39) unclassified probably benign
R6776:Chd3 UTSW 11 69,245,296 (GRCm39) missense probably damaging 1.00
R6900:Chd3 UTSW 11 69,245,271 (GRCm39) missense possibly damaging 0.64
R7085:Chd3 UTSW 11 69,260,027 (GRCm39) missense unknown
R7136:Chd3 UTSW 11 69,239,264 (GRCm39) missense probably null 0.37
R7164:Chd3 UTSW 11 69,253,132 (GRCm39) missense probably damaging 1.00
R7200:Chd3 UTSW 11 69,254,921 (GRCm39) missense possibly damaging 0.94
R7226:Chd3 UTSW 11 69,260,037 (GRCm39) missense unknown
R7238:Chd3 UTSW 11 69,254,873 (GRCm39) missense probably benign 0.31
R7316:Chd3 UTSW 11 69,236,394 (GRCm39) missense probably damaging 0.99
R7560:Chd3 UTSW 11 69,247,096 (GRCm39) missense probably damaging 1.00
R7684:Chd3 UTSW 11 69,248,692 (GRCm39) missense possibly damaging 0.83
R7748:Chd3 UTSW 11 69,246,459 (GRCm39) missense probably benign 0.00
R7820:Chd3 UTSW 11 69,244,064 (GRCm39) missense probably damaging 1.00
R7885:Chd3 UTSW 11 69,247,451 (GRCm39) missense probably benign 0.13
R8150:Chd3 UTSW 11 69,254,510 (GRCm39) missense probably benign 0.02
R8161:Chd3 UTSW 11 69,241,711 (GRCm39) missense probably damaging 1.00
R8271:Chd3 UTSW 11 69,251,483 (GRCm39) missense probably damaging 1.00
R8334:Chd3 UTSW 11 69,241,622 (GRCm39) missense probably damaging 1.00
R8423:Chd3 UTSW 11 69,245,252 (GRCm39) nonsense probably null
R8690:Chd3 UTSW 11 69,246,648 (GRCm39) critical splice acceptor site probably benign
R8828:Chd3 UTSW 11 69,247,097 (GRCm39) missense probably damaging 1.00
R8857:Chd3 UTSW 11 69,253,146 (GRCm39) missense probably benign 0.22
R9124:Chd3 UTSW 11 69,260,162 (GRCm39) missense unknown
R9170:Chd3 UTSW 11 69,241,648 (GRCm39) missense possibly damaging 0.64
R9213:Chd3 UTSW 11 69,255,628 (GRCm39) missense possibly damaging 0.53
R9285:Chd3 UTSW 11 69,249,954 (GRCm39) missense possibly damaging 0.64
R9293:Chd3 UTSW 11 69,244,027 (GRCm39) missense possibly damaging 0.94
R9368:Chd3 UTSW 11 69,251,200 (GRCm39) missense probably damaging 1.00
R9521:Chd3 UTSW 11 69,249,133 (GRCm39) missense probably benign 0.01
R9544:Chd3 UTSW 11 69,241,046 (GRCm39) missense probably damaging 1.00
R9554:Chd3 UTSW 11 69,251,015 (GRCm39) missense probably damaging 1.00
R9588:Chd3 UTSW 11 69,241,046 (GRCm39) missense probably damaging 1.00
X0022:Chd3 UTSW 11 69,247,084 (GRCm39) missense probably damaging 1.00
X0062:Chd3 UTSW 11 69,245,271 (GRCm39) missense possibly damaging 0.64
Z1186:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1186:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1187:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1187:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1188:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1188:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1189:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1189:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1190:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1190:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1191:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1191:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1192:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1192:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCTACAAAGTCCAGCTCTG -3'
(R):5'- CAGAGCCTAGAAATCCTCTGC -3'

Sequencing Primer
(F):5'- AGCTCTGGTGGCATCCCTC -3'
(R):5'- AGAGATCAATTGCTGGTCCATG -3'
Posted On 2015-03-18