Mutagenetix > Incidental Mutation

Incidental Mutation 'R3759:Barx1'

270485

Institutional Source

Beutler Lab

Gene Symbol

Barx1

Ensembl Gene

ENSMUSG00000021381

Gene Name

BarH-like homeobox 1

Synonyms

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3759 (G1)

Quality Score

201

Status

Not validated

Chromosome

Chromosomal Location

48816512-48819983 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 48818649 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Proline at position 124 (R124P)

Ref Sequence

ENSEMBL: ENSMUSP00000021813 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021813]

AlphaFold

Q9ER42

Predicted Effect

probably damaging
Transcript: ENSMUST00000021813
AA Change: R124P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000021813
Gene: ENSMUSG00000021381
AA Change: R124P

Domain	Start	End	E-Value	Type
low complexity region	38	54	N/A	INTRINSIC
low complexity region	88	115	N/A	INTRINSIC
HOX	142	204	9.05e-25	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Bar subclass of homeobox transcription factors. Studies of the mouse and chick homolog suggest the encoded protein may play a role in developing teeth and craniofacial mesenchyme of neural crest origin. The protein may also be associated with differentiation of stomach epithelia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation die around E13 embryonic stage with shrunken and malformed stomach or shortly after birth with cleft palate and abnormal tooth development depending on strain background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 10 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Capn13	T	A	17: 73,629,072 (GRCm39)	R578S	probably benign	Het
Ct45a	C	T	X: 55,590,568 (GRCm39)	V78I	probably benign	Het
Erc2	A	G	14: 27,747,120 (GRCm39)	Q684R	possibly damaging	Het
Grm4	G	A	17: 27,654,273 (GRCm39)	T559I	probably benign	Het
Heatr5b	G	T	17: 79,131,969 (GRCm39)	A378D	possibly damaging	Het
Ppfia1	A	G	7: 144,069,739 (GRCm39)	V398A	probably benign	Het
Ppip5k2	C	T	1: 97,683,610 (GRCm39)		probably null	Het
Pramel23	C	A	4: 143,423,721 (GRCm39)	C356F	probably damaging	Het
Rsf1	G	GACGGCGGCA	7: 97,229,116 (GRCm39)		probably benign	Het
Tbc1d8	T	C	1: 39,415,546 (GRCm39)	N913S	probably damaging	Het

Other mutations in Barx1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0323:Barx1	UTSW	13	48,819,430 (GRCm39)	missense	probably benign
R3819:Barx1	UTSW	13	48,818,960 (GRCm39)	missense	possibly damaging	0.83
R7263:Barx1	UTSW	13	48,818,555 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGGAATCCAGTTCACCCAG -3'
(R):5'- ATCTATTCTGGAAAGAGTAACGCACAC -3'

Sequencing Primer
(F):5'- GGAATCCAGTTCACCCAGATCTTTC -3'
(R):5'- GAGTAACGCACACCCTCAG -3'

Posted On

2015-03-18