Incidental Mutation 'R3760:Adgrl2'
ID 270497
Institutional Source Beutler Lab
Gene Symbol Adgrl2
Ensembl Gene ENSMUSG00000028184
Gene Name adhesion G protein-coupled receptor L2
Synonyms Lphn2, Lphh1, Lec1
MMRRC Submission 040740-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3760 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 148521219-148696191 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 148522871 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1448 (E1448G)
Ref Sequence ENSEMBL: ENSMUSP00000143150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106128] [ENSMUST00000168352] [ENSMUST00000195988] [ENSMUST00000196526] [ENSMUST00000197567] [ENSMUST00000199238] [ENSMUST00000198779] [ENSMUST00000199059] [ENSMUST00000199750] [ENSMUST00000200543] [ENSMUST00000200154]
AlphaFold Q8JZZ7
Predicted Effect probably damaging
Transcript: ENSMUST00000106128
AA Change: E1468G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101734
Gene: ENSMUSG00000028184
AA Change: E1468G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 2.5e-26 PFAM
OLF 142 398 5.22e-140 SMART
HormR 469 534 3.14e-20 SMART
Pfam:GAIN 537 764 1.3e-58 PFAM
GPS 788 840 3.47e-25 SMART
Pfam:7tm_2 848 1108 4.6e-69 PFAM
Pfam:Latrophilin 1128 1487 6.4e-181 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168352
AA Change: E220G

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132116
Gene: ENSMUSG00000028184
AA Change: E220G

DomainStartEndE-ValueType
Pfam:Latrophilin 1 239 2.5e-122 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000195988
AA Change: E1416G

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143444
Gene: ENSMUSG00000028184
AA Change: E1416G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.3e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.1e-66 PFAM
Pfam:Latrophilin 1119 1189 2.2e-28 PFAM
Pfam:Latrophilin 1184 1435 5.5e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196526
SMART Domains Protein: ENSMUSP00000143788
Gene: ENSMUSG00000028184

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 8.7e-24 PFAM
OLF 138 394 3.4e-142 SMART
HormR 465 530 2e-22 SMART
Pfam:GAIN 533 747 1.1e-54 PFAM
GPS 771 823 2.2e-27 SMART
Pfam:7tm_2 831 1067 6.5e-68 PFAM
Pfam:Latrophilin 1087 1158 9.9e-36 PFAM
low complexity region 1163 1173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197348
Predicted Effect probably damaging
Transcript: ENSMUST00000197567
AA Change: E1468G

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143626
Gene: ENSMUSG00000028184
AA Change: E1468G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 1.9e-26 PFAM
OLF 142 398 5.22e-140 SMART
HormR 469 534 3.14e-20 SMART
Pfam:GAIN 537 764 1.1e-58 PFAM
GPS 788 840 3.47e-25 SMART
Pfam:7tm_2 848 1108 6.4e-69 PFAM
Pfam:Latrophilin 1128 1487 2.8e-181 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199238
AA Change: E1459G

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142405
Gene: ENSMUSG00000028184
AA Change: E1459G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.4e-66 PFAM
Pfam:Latrophilin 1119 1478 1.6e-187 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198779
AA Change: E1433G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142347
Gene: ENSMUSG00000028184
AA Change: E1433G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1084 1.8e-66 PFAM
Pfam:Latrophilin 1104 1452 7e-174 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199059
AA Change: E1448G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143150
Gene: ENSMUSG00000028184
AA Change: E1448G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.3e-66 PFAM
Pfam:Latrophilin 1119 1467 7.1e-174 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199750
AA Change: E1322G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000143320
Gene: ENSMUSG00000028184
AA Change: E1322G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.1e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 403 468 1.9e-22 SMART
GPS 709 761 2.1e-27 SMART
Pfam:7tm_2 769 1005 1.6e-66 PFAM
Pfam:Latrophilin 1025 1095 2e-28 PFAM
Pfam:Latrophilin 1090 1341 4.9e-123 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200543
AA Change: E1384G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142336
Gene: ENSMUSG00000028184
AA Change: E1384G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.2e-23 PFAM
OLF 138 394 3.3e-142 SMART
HormR 465 530 2e-22 SMART
GPS 771 823 2.1e-27 SMART
Pfam:7tm_2 831 1067 1.7e-66 PFAM
Pfam:Latrophilin 1087 1157 2.1e-28 PFAM
Pfam:Latrophilin 1152 1403 5.3e-123 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000198139
AA Change: E451G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200023
Predicted Effect probably benign
Transcript: ENSMUST00000200216
Predicted Effect probably benign
Transcript: ENSMUST00000197925
Predicted Effect probably benign
Transcript: ENSMUST00000200456
Predicted Effect probably benign
Transcript: ENSMUST00000200154
SMART Domains Protein: ENSMUSP00000142865
Gene: ENSMUSG00000028184

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 2.5e-23 PFAM
OLF 138 394 3.3e-142 SMART
HormR 465 530 2e-22 SMART
GPS 771 823 2.1e-27 SMART
Pfam:7tm_2 831 1067 1.2e-66 PFAM
Pfam:Latrophilin 1087 1123 2.2e-4 PFAM
Meta Mutation Damage Score 0.2070 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors. The encoded protein participates in the regulation of exocytosis. The proprotein is thought to be further cleaved within a cysteine-rich G-protein-coupled receptor proteolysis site into two chains that are non-covalently bound at the cell membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice die prenatally at fetal stages. Heterozygous mice exhibit decreased locomotor activity in an open field test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Ct45a C T X: 55,590,568 (GRCm39) V78I probably benign Het
Ell2 A T 13: 75,910,281 (GRCm39) Q163L probably benign Het
Epha6 T A 16: 60,041,347 (GRCm39) T423S possibly damaging Het
Fhad1 T C 4: 141,637,124 (GRCm39) E1114G probably damaging Het
Gpr83 A T 9: 14,772,034 (GRCm39) T69S probably benign Het
Gramd1c A T 16: 43,818,154 (GRCm39) M342K probably damaging Het
H3c7 T C 13: 23,728,985 (GRCm39) C111R probably damaging Het
Idua T C 5: 108,817,978 (GRCm39) probably benign Het
Kcnh1 T C 1: 192,188,332 (GRCm39) L931P probably damaging Het
Map2 T A 1: 66,478,077 (GRCm39) S470T probably damaging Het
Map7 T C 10: 20,152,027 (GRCm39) probably benign Het
Obscn A G 11: 58,919,406 (GRCm39) L6213P probably damaging Het
Or5b109 T C 19: 13,212,250 (GRCm39) L212P probably damaging Het
Or8k38 G A 2: 86,488,232 (GRCm39) S190L possibly damaging Het
Pcnx4 C T 12: 72,613,780 (GRCm39) T575M probably damaging Het
Ppp1r12a A G 10: 108,100,595 (GRCm39) D348G probably damaging Het
Prrc2c T C 1: 162,520,420 (GRCm39) N730S probably damaging Het
Serpinb3d C T 1: 107,009,304 (GRCm39) probably benign Het
Skint6 T C 4: 112,794,655 (GRCm39) T705A possibly damaging Het
Slc6a20a A G 9: 123,492,054 (GRCm39) I50T probably damaging Het
Taf13 T C 3: 108,485,424 (GRCm39) probably benign Het
Tlr11 A T 14: 50,599,700 (GRCm39) E562V probably damaging Het
Uhrf2 T C 19: 30,051,331 (GRCm39) S302P probably benign Het
Ulk1 C T 5: 110,937,223 (GRCm39) R691Q probably benign Het
Unc79 T A 12: 103,058,964 (GRCm39) L1036Q probably damaging Het
Vmn1r85 A T 7: 12,818,932 (GRCm39) S71T probably damaging Het
Vmn2r-ps158 G A 7: 42,673,502 (GRCm39) E187K probably benign Het
Vps52 T C 17: 34,179,162 (GRCm39) F200L possibly damaging Het
Zfp521 T C 18: 13,977,686 (GRCm39) H909R possibly damaging Het
Other mutations in Adgrl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Adgrl2 APN 3 148,571,244 (GRCm39) missense probably damaging 0.99
IGL00572:Adgrl2 APN 3 148,532,134 (GRCm39) missense probably damaging 1.00
IGL01624:Adgrl2 APN 3 148,542,163 (GRCm39) missense probably damaging 1.00
IGL01796:Adgrl2 APN 3 148,564,611 (GRCm39) missense probably damaging 1.00
IGL02380:Adgrl2 APN 3 148,534,125 (GRCm39) nonsense probably null
IGL02468:Adgrl2 APN 3 148,596,116 (GRCm39) missense probably damaging 1.00
IGL02708:Adgrl2 APN 3 148,532,161 (GRCm39) missense probably damaging 0.96
IGL02869:Adgrl2 APN 3 148,596,241 (GRCm39) missense probably damaging 1.00
IGL03248:Adgrl2 APN 3 148,523,036 (GRCm39) missense probably damaging 1.00
IGL03343:Adgrl2 APN 3 148,565,016 (GRCm39) missense probably damaging 0.98
P0157:Adgrl2 UTSW 3 148,564,699 (GRCm39) missense probably damaging 1.00
PIT4382001:Adgrl2 UTSW 3 148,522,934 (GRCm39) missense
PIT4544001:Adgrl2 UTSW 3 148,596,157 (GRCm39) missense probably damaging 1.00
R0165:Adgrl2 UTSW 3 148,558,499 (GRCm39) splice site probably benign
R0242:Adgrl2 UTSW 3 148,544,821 (GRCm39) splice site probably null
R0242:Adgrl2 UTSW 3 148,544,821 (GRCm39) splice site probably null
R0344:Adgrl2 UTSW 3 148,571,231 (GRCm39) splice site probably null
R0488:Adgrl2 UTSW 3 148,552,541 (GRCm39) missense probably damaging 1.00
R0542:Adgrl2 UTSW 3 148,564,854 (GRCm39) missense probably damaging 1.00
R0630:Adgrl2 UTSW 3 148,544,880 (GRCm39) missense probably damaging 0.98
R0674:Adgrl2 UTSW 3 148,543,315 (GRCm39) missense possibly damaging 0.91
R1401:Adgrl2 UTSW 3 148,528,617 (GRCm39) missense probably damaging 0.99
R1543:Adgrl2 UTSW 3 148,564,909 (GRCm39) missense probably damaging 1.00
R1575:Adgrl2 UTSW 3 148,558,398 (GRCm39) missense probably benign 0.17
R1645:Adgrl2 UTSW 3 148,571,244 (GRCm39) missense probably damaging 1.00
R1780:Adgrl2 UTSW 3 148,558,229 (GRCm39) missense probably damaging 1.00
R1992:Adgrl2 UTSW 3 148,522,880 (GRCm39) missense possibly damaging 0.89
R2014:Adgrl2 UTSW 3 148,532,111 (GRCm39) missense probably damaging 1.00
R2130:Adgrl2 UTSW 3 148,596,124 (GRCm39) missense probably damaging 0.99
R2131:Adgrl2 UTSW 3 148,596,124 (GRCm39) missense probably damaging 0.99
R2400:Adgrl2 UTSW 3 148,557,570 (GRCm39) missense probably damaging 1.00
R2997:Adgrl2 UTSW 3 148,523,285 (GRCm39) missense probably damaging 1.00
R3161:Adgrl2 UTSW 3 148,523,187 (GRCm39) missense probably damaging 1.00
R3416:Adgrl2 UTSW 3 148,564,965 (GRCm39) missense probably damaging 1.00
R3417:Adgrl2 UTSW 3 148,564,965 (GRCm39) missense probably damaging 1.00
R3551:Adgrl2 UTSW 3 148,564,599 (GRCm39) missense probably damaging 1.00
R4355:Adgrl2 UTSW 3 148,544,788 (GRCm39) missense probably damaging 1.00
R4850:Adgrl2 UTSW 3 148,564,656 (GRCm39) missense probably damaging 1.00
R4911:Adgrl2 UTSW 3 148,596,099 (GRCm39) missense probably damaging 0.99
R4945:Adgrl2 UTSW 3 148,528,672 (GRCm39) missense probably damaging 0.99
R5313:Adgrl2 UTSW 3 148,529,349 (GRCm39) missense probably damaging 1.00
R5339:Adgrl2 UTSW 3 148,523,480 (GRCm39) missense probably benign 0.01
R5540:Adgrl2 UTSW 3 148,543,198 (GRCm39) critical splice donor site probably null
R5583:Adgrl2 UTSW 3 148,564,800 (GRCm39) missense probably damaging 1.00
R5890:Adgrl2 UTSW 3 148,564,811 (GRCm39) missense probably damaging 1.00
R6170:Adgrl2 UTSW 3 148,528,645 (GRCm39) missense probably damaging 1.00
R6197:Adgrl2 UTSW 3 148,564,578 (GRCm39) missense probably damaging 1.00
R6284:Adgrl2 UTSW 3 148,532,143 (GRCm39) missense probably damaging 1.00
R6877:Adgrl2 UTSW 3 148,522,922 (GRCm39) missense probably damaging 1.00
R7048:Adgrl2 UTSW 3 148,552,565 (GRCm39) missense probably damaging 1.00
R7205:Adgrl2 UTSW 3 148,564,585 (GRCm39) missense probably damaging 1.00
R7326:Adgrl2 UTSW 3 148,552,506 (GRCm39) missense probably benign 0.00
R7348:Adgrl2 UTSW 3 148,523,402 (GRCm39) missense
R7382:Adgrl2 UTSW 3 148,522,919 (GRCm39) missense
R7486:Adgrl2 UTSW 3 148,523,330 (GRCm39) missense
R7498:Adgrl2 UTSW 3 148,564,852 (GRCm39) nonsense probably null
R7644:Adgrl2 UTSW 3 148,544,789 (GRCm39) missense probably damaging 1.00
R7690:Adgrl2 UTSW 3 148,522,934 (GRCm39) missense
R7742:Adgrl2 UTSW 3 148,542,064 (GRCm39) missense probably damaging 1.00
R7745:Adgrl2 UTSW 3 148,542,094 (GRCm39) missense probably damaging 1.00
R8291:Adgrl2 UTSW 3 148,556,554 (GRCm39) missense possibly damaging 0.93
R8326:Adgrl2 UTSW 3 148,533,190 (GRCm39) missense
R8343:Adgrl2 UTSW 3 148,552,542 (GRCm39) missense probably damaging 1.00
R8344:Adgrl2 UTSW 3 148,565,161 (GRCm39) missense probably damaging 0.98
R8487:Adgrl2 UTSW 3 148,565,122 (GRCm39) missense probably benign 0.06
R8748:Adgrl2 UTSW 3 148,532,026 (GRCm39) missense
R8769:Adgrl2 UTSW 3 148,522,917 (GRCm39) missense
R8804:Adgrl2 UTSW 3 148,552,652 (GRCm39) missense probably damaging 1.00
R8911:Adgrl2 UTSW 3 148,558,163 (GRCm39) intron probably benign
R8943:Adgrl2 UTSW 3 148,534,119 (GRCm39) missense probably damaging 1.00
R8977:Adgrl2 UTSW 3 148,660,223 (GRCm39) missense probably null
R9030:Adgrl2 UTSW 3 148,544,761 (GRCm39) missense possibly damaging 0.74
R9105:Adgrl2 UTSW 3 148,543,289 (GRCm39) missense possibly damaging 0.82
R9427:Adgrl2 UTSW 3 148,526,068 (GRCm39) missense
R9471:Adgrl2 UTSW 3 148,558,365 (GRCm39) missense probably benign
R9646:Adgrl2 UTSW 3 148,544,926 (GRCm39) missense probably damaging 0.96
R9742:Adgrl2 UTSW 3 148,541,986 (GRCm39) critical splice donor site probably null
RF007:Adgrl2 UTSW 3 148,544,884 (GRCm39) missense probably damaging 1.00
X0009:Adgrl2 UTSW 3 148,558,290 (GRCm39) missense probably damaging 1.00
X0019:Adgrl2 UTSW 3 148,571,230 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- CCGTTTTACTACAAGTGGAGAACC -3'
(R):5'- GAGCATGCCCAACCTAAGAG -3'

Sequencing Primer
(F):5'- TGGAGAACCATGGGCCAAC -3'
(R):5'- TAAGAGACTCTCCCTACCCGG -3'
Posted On 2015-03-18