Incidental Mutation 'R3760:Skint6'
ID270498
Institutional Source Beutler Lab
Gene Symbol Skint6
Ensembl Gene ENSMUSG00000087194
Gene Nameselection and upkeep of intraepithelial T cells 6
SynonymsOTTMUSG00000008519
MMRRC Submission 040740-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R3760 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location112804616-113286973 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112937458 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 705 (T705A)
Ref Sequence ENSEMBL: ENSMUSP00000132312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134494
Predicted Effect possibly damaging
Transcript: ENSMUST00000138966
AA Change: T705A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: T705A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171224
AA Change: T705A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: T705A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,817,235 E1448G probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Ell2 A T 13: 75,762,162 Q163L probably benign Het
Epha6 T A 16: 60,220,984 T423S possibly damaging Het
Fhad1 T C 4: 141,909,813 E1114G probably damaging Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gm9268 G A 7: 43,024,078 E187K probably benign Het
Gpr83 A T 9: 14,860,738 T69S probably benign Het
Gramd1c A T 16: 43,997,791 M342K probably damaging Het
Hist1h3f T C 13: 23,544,815 C111R probably damaging Het
Idua T C 5: 108,670,112 probably benign Het
Kcnh1 T C 1: 192,506,024 L931P probably damaging Het
Map2 T A 1: 66,438,918 S470T probably damaging Het
Map7 T C 10: 20,276,281 probably benign Het
Obscn A G 11: 59,028,580 L6213P probably damaging Het
Olfr1085 G A 2: 86,657,888 S190L possibly damaging Het
Olfr1463 T C 19: 13,234,886 L212P probably damaging Het
Pcnx4 C T 12: 72,567,006 T575M probably damaging Het
Ppp1r12a A G 10: 108,264,734 D348G probably damaging Het
Prrc2c T C 1: 162,692,851 N730S probably damaging Het
Serpinb3d C T 1: 107,081,574 probably benign Het
Slc6a20a A G 9: 123,662,989 I50T probably damaging Het
Taf13 T C 3: 108,578,108 probably benign Het
Tlr11 A T 14: 50,362,243 E562V probably damaging Het
Uhrf2 T C 19: 30,073,931 S302P probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc79 T A 12: 103,092,705 L1036Q probably damaging Het
Vmn1r85 A T 7: 13,085,005 S71T probably damaging Het
Vps52 T C 17: 33,960,188 F200L possibly damaging Het
Zfp521 T C 18: 13,844,629 H909R possibly damaging Het
Other mutations in Skint6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Skint6 APN 4 112804682 missense possibly damaging 0.96
IGL01296:Skint6 APN 4 113236440 missense probably benign 0.37
IGL01343:Skint6 APN 4 113283626 missense probably benign 0.07
IGL01543:Skint6 APN 4 112899963 missense probably benign 0.18
IGL01633:Skint6 APN 4 113238049 missense probably damaging 1.00
IGL01818:Skint6 APN 4 112948569 missense probably benign 0.18
IGL02124:Skint6 APN 4 113087796 missense probably benign
IGL02517:Skint6 APN 4 112948540 splice site probably benign
IGL02647:Skint6 APN 4 113127891 splice site probably benign
IGL02887:Skint6 APN 4 113238184 nonsense probably null
IGL03026:Skint6 APN 4 112991244 splice site probably null
IGL03030:Skint6 APN 4 113012956 missense probably benign 0.03
PIT4576001:Skint6 UTSW 4 113053367 missense possibly damaging 0.91
R0058:Skint6 UTSW 4 113046815 splice site probably benign
R0058:Skint6 UTSW 4 113046815 splice site probably benign
R0099:Skint6 UTSW 4 112811501 missense possibly damaging 0.53
R0158:Skint6 UTSW 4 113184814 splice site probably benign
R0164:Skint6 UTSW 4 112991236 splice site probably benign
R0312:Skint6 UTSW 4 112809100 missense possibly damaging 0.86
R0591:Skint6 UTSW 4 112858169 splice site probably benign
R0762:Skint6 UTSW 4 112865651 splice site probably benign
R0941:Skint6 UTSW 4 113238358 missense probably damaging 1.00
R1023:Skint6 UTSW 4 113238103 missense probably benign 0.20
R1132:Skint6 UTSW 4 112898099 critical splice donor site probably null
R1228:Skint6 UTSW 4 112854452 missense probably benign
R1338:Skint6 UTSW 4 113012961 missense possibly damaging 0.53
R1432:Skint6 UTSW 4 112869524 splice site probably benign
R1512:Skint6 UTSW 4 113238132 missense probably damaging 1.00
R1577:Skint6 UTSW 4 113148523 missense possibly damaging 0.53
R1733:Skint6 UTSW 4 113177037 splice site probably benign
R1762:Skint6 UTSW 4 113236481 missense probably damaging 0.98
R1891:Skint6 UTSW 4 112846696 missense possibly damaging 0.85
R1908:Skint6 UTSW 4 112891990 missense probably benign
R2069:Skint6 UTSW 4 113238132 missense probably damaging 1.00
R2089:Skint6 UTSW 4 112846684 missense probably benign
R2091:Skint6 UTSW 4 112846684 missense probably benign
R2091:Skint6 UTSW 4 112846684 missense probably benign
R2144:Skint6 UTSW 4 113236260 missense possibly damaging 0.84
R2166:Skint6 UTSW 4 112854452 missense probably benign 0.01
R2192:Skint6 UTSW 4 112865712 nonsense probably null
R2267:Skint6 UTSW 4 112842822 intron probably null
R2312:Skint6 UTSW 4 113238142 missense probably damaging 1.00
R2324:Skint6 UTSW 4 112872457 splice site probably null
R2342:Skint6 UTSW 4 113176983 missense probably benign 0.00
R3028:Skint6 UTSW 4 113236493 missense possibly damaging 0.92
R3704:Skint6 UTSW 4 113136472 missense possibly damaging 0.86
R3752:Skint6 UTSW 4 112842899 splice site probably benign
R3827:Skint6 UTSW 4 112937437 missense probably benign
R4377:Skint6 UTSW 4 113236518 missense possibly damaging 0.90
R4406:Skint6 UTSW 4 113156486 missense probably benign 0.01
R4611:Skint6 UTSW 4 113074076 missense probably benign
R4780:Skint6 UTSW 4 113236397 missense probably damaging 0.98
R4788:Skint6 UTSW 4 113238336 missense possibly damaging 0.54
R4818:Skint6 UTSW 4 112955392 intron probably benign
R4900:Skint6 UTSW 4 113067470 missense probably benign 0.03
R4972:Skint6 UTSW 4 112835068 missense probably benign
R5008:Skint6 UTSW 4 112991255 missense possibly damaging 0.86
R5016:Skint6 UTSW 4 113171533 critical splice acceptor site probably null
R5085:Skint6 UTSW 4 113236268 missense probably damaging 0.99
R5165:Skint6 UTSW 4 112865668 missense possibly damaging 0.86
R5221:Skint6 UTSW 4 112894924 intron probably null
R5310:Skint6 UTSW 4 113184768 nonsense probably null
R5423:Skint6 UTSW 4 112850740 missense possibly damaging 0.93
R5436:Skint6 UTSW 4 113096591 missense probably benign 0.08
R5447:Skint6 UTSW 4 113105909 missense probably benign 0.34
R5564:Skint6 UTSW 4 112988965 missense possibly damaging 0.72
R5629:Skint6 UTSW 4 113012979 missense possibly damaging 0.86
R5936:Skint6 UTSW 4 113096593 missense probably benign 0.33
R5993:Skint6 UTSW 4 112809079 missense probably benign 0.02
R6027:Skint6 UTSW 4 113096564 splice site probably null
R6174:Skint6 UTSW 4 112839313 missense possibly damaging 0.53
R6497:Skint6 UTSW 4 113236398 missense probably damaging 0.98
R6552:Skint6 UTSW 4 113067490 missense possibly damaging 0.86
R6645:Skint6 UTSW 4 112892038 missense possibly damaging 0.53
R6810:Skint6 UTSW 4 112948380 intron probably null
R7003:Skint6 UTSW 4 113105912 missense probably benign 0.01
R7211:Skint6 UTSW 4 113238369 missense probably benign 0.09
R7269:Skint6 UTSW 4 112854489 intron probably null
R7398:Skint6 UTSW 4 112898138 missense probably benign 0.00
R7438:Skint6 UTSW 4 113238228 missense probably damaging 1.00
R7536:Skint6 UTSW 4 112811547 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCAATGTTACATAAACTCCTGTTTTCC -3'
(R):5'- AGAGAGATAGCCAAGGCCATTT -3'

Sequencing Primer
(F):5'- CCCAAGCAGCCTATTTCGATAATTTG -3'
(R):5'- TTGCCTCTTGTGAATTAGGAAAG -3'
Posted On2015-03-18