Incidental Mutation 'R3761:Il16'
ID 270536
Institutional Source Beutler Lab
Gene Symbol Il16
Ensembl Gene ENSMUSG00000001741
Gene Name interleukin 16
Synonyms
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.255) question?
Stock # R3761 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 83292033-83394934 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 83300093 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 400 (L400S)
Ref Sequence ENSEMBL: ENSMUSP00000146496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001792] [ENSMUST00000117410] [ENSMUST00000145610]
AlphaFold O54824
Predicted Effect possibly damaging
Transcript: ENSMUST00000001792
AA Change: L1098S

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000001792
Gene: ENSMUSG00000001741
AA Change: L1098S

DomainStartEndE-ValueType
low complexity region 76 92 N/A INTRINSIC
low complexity region 99 115 N/A INTRINSIC
PDZ 222 300 6.5e-23 SMART
PDZ 361 438 3.89e-12 SMART
low complexity region 507 526 N/A INTRINSIC
low complexity region 556 577 N/A INTRINSIC
low complexity region 589 602 N/A INTRINSIC
low complexity region 647 680 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 825 839 N/A INTRINSIC
low complexity region 978 989 N/A INTRINSIC
PDZ 1115 1192 3.6e-16 SMART
low complexity region 1201 1216 N/A INTRINSIC
PDZ 1234 1310 4.11e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117410
SMART Domains Protein: ENSMUSP00000112781
Gene: ENSMUSG00000046027

DomainStartEndE-ValueType
Pfam:START 7 196 5.9e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000145610
AA Change: L400S

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151047
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pleiotropic cytokine that functions as a chemoattractant, a modulator of T cell activation, and an inhibitor of HIV replication. The signaling process of this cytokine is mediated by CD4. The product of this gene undergoes proteolytic processing, which is found to yield two functional proteins. The cytokine function is exclusively attributed to the secreted C-terminal peptide, while the N-terminal product may play a role in cell cycle control. Caspase 3 is reported to be involved in the proteolytic processing of this protein. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele display a transient but consistent increase of thymidine incorporation in anti-CD3-stimulated CD4+ T cells, but fail to show a hyperproliferative T cell phenotype using BrdU labeling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2cl A G 9: 110,727,202 (GRCm39) T923A probably damaging Het
Ccdc91 A T 6: 147,464,200 (GRCm39) D216V unknown Het
Clstn3 A G 6: 124,434,835 (GRCm39) V360A possibly damaging Het
Ct45a C T X: 55,590,568 (GRCm39) V78I probably benign Het
Ehmt2 A G 17: 35,132,707 (GRCm39) I1235V probably damaging Het
Eif3e C T 15: 43,124,480 (GRCm39) R346H probably damaging Het
Esrp2 T C 8: 106,860,254 (GRCm39) D301G probably damaging Het
Fam174a G T 1: 95,241,971 (GRCm39) V144F probably damaging Het
Fbxo31 A T 8: 122,287,169 (GRCm39) W135R possibly damaging Het
Heatr5b A G 17: 79,137,071 (GRCm39) S150P probably damaging Het
Or10d1c A T 9: 38,893,662 (GRCm39) I226N possibly damaging Het
Ryr3 A G 2: 112,585,258 (GRCm39) F2776S probably benign Het
Sema3d T C 5: 12,621,004 (GRCm39) Y537H probably damaging Het
Sh3pxd2b T C 11: 32,372,750 (GRCm39) V639A probably benign Het
Slc39a10 A G 1: 46,851,285 (GRCm39) V735A possibly damaging Het
Slc45a2 T A 15: 11,012,800 (GRCm39) Y268N probably benign Het
Tmco5 A G 2: 116,717,787 (GRCm39) probably null Het
Ulk1 C T 5: 110,937,223 (GRCm39) R691Q probably benign Het
Wwp1 A T 4: 19,631,085 (GRCm39) H649Q probably damaging Het
Other mutations in Il16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Il16 APN 7 83,301,666 (GRCm39) missense probably benign 0.02
IGL01743:Il16 APN 7 83,301,507 (GRCm39) missense probably benign 0.00
IGL01770:Il16 APN 7 83,322,234 (GRCm39) splice site probably benign
IGL02025:Il16 APN 7 83,302,056 (GRCm39) missense probably damaging 1.00
IGL02317:Il16 APN 7 83,316,097 (GRCm39) missense probably damaging 1.00
IGL02412:Il16 APN 7 83,301,899 (GRCm39) missense probably benign 0.03
IGL02550:Il16 APN 7 83,323,704 (GRCm39) missense possibly damaging 0.90
IGL02568:Il16 APN 7 83,310,484 (GRCm39) missense probably damaging 1.00
IGL02578:Il16 APN 7 83,327,194 (GRCm39) critical splice donor site probably null
IGL02815:Il16 APN 7 83,300,249 (GRCm39) missense probably damaging 0.98
IGL03157:Il16 APN 7 83,371,611 (GRCm39) missense probably damaging 1.00
IGL03161:Il16 APN 7 83,371,707 (GRCm39) missense probably damaging 1.00
IGL03188:Il16 APN 7 83,337,371 (GRCm39) missense probably benign 0.00
IGL03213:Il16 APN 7 83,295,708 (GRCm39) missense probably damaging 1.00
IGL03274:Il16 APN 7 83,310,442 (GRCm39) missense probably damaging 1.00
R0201:Il16 UTSW 7 83,371,516 (GRCm39) missense probably damaging 0.99
R0309:Il16 UTSW 7 83,371,762 (GRCm39) missense probably damaging 1.00
R0597:Il16 UTSW 7 83,327,183 (GRCm39) splice site probably benign
R0942:Il16 UTSW 7 83,312,349 (GRCm39) missense probably benign 0.01
R1018:Il16 UTSW 7 83,323,746 (GRCm39) missense probably damaging 1.00
R1434:Il16 UTSW 7 83,304,520 (GRCm39) missense probably benign
R1715:Il16 UTSW 7 83,297,936 (GRCm39) missense probably benign 0.01
R2179:Il16 UTSW 7 83,337,287 (GRCm39) splice site probably null
R2520:Il16 UTSW 7 83,301,202 (GRCm39) missense probably benign 0.03
R3425:Il16 UTSW 7 83,293,248 (GRCm39) missense probably damaging 1.00
R3943:Il16 UTSW 7 83,301,223 (GRCm39) missense probably damaging 0.97
R4470:Il16 UTSW 7 83,300,046 (GRCm39) intron probably benign
R4530:Il16 UTSW 7 83,330,518 (GRCm39) intron probably benign
R4583:Il16 UTSW 7 83,332,107 (GRCm39) missense probably damaging 1.00
R4777:Il16 UTSW 7 83,300,104 (GRCm39) missense probably benign 0.14
R4874:Il16 UTSW 7 83,310,153 (GRCm39) missense possibly damaging 0.56
R4876:Il16 UTSW 7 83,322,302 (GRCm39) missense probably benign
R5677:Il16 UTSW 7 83,323,761 (GRCm39) missense probably damaging 1.00
R5686:Il16 UTSW 7 83,297,936 (GRCm39) missense probably benign 0.36
R5920:Il16 UTSW 7 83,301,552 (GRCm39) missense probably benign 0.03
R6115:Il16 UTSW 7 83,301,775 (GRCm39) nonsense probably null
R6459:Il16 UTSW 7 83,371,536 (GRCm39) missense probably damaging 1.00
R6459:Il16 UTSW 7 83,371,529 (GRCm39) missense probably damaging 1.00
R6601:Il16 UTSW 7 83,371,677 (GRCm39) missense probably damaging 1.00
R6616:Il16 UTSW 7 83,295,684 (GRCm39) missense probably benign 0.37
R6642:Il16 UTSW 7 83,337,335 (GRCm39) missense probably benign 0.03
R6721:Il16 UTSW 7 83,312,270 (GRCm39) critical splice donor site probably null
R7009:Il16 UTSW 7 83,295,596 (GRCm39) missense probably benign
R7144:Il16 UTSW 7 83,295,659 (GRCm39) missense probably damaging 0.97
R7346:Il16 UTSW 7 83,293,249 (GRCm39) missense probably damaging 1.00
R7403:Il16 UTSW 7 83,319,343 (GRCm39) missense probably damaging 1.00
R7499:Il16 UTSW 7 83,323,702 (GRCm39) missense probably damaging 0.99
R7814:Il16 UTSW 7 83,319,348 (GRCm39) missense possibly damaging 0.46
R7941:Il16 UTSW 7 83,332,037 (GRCm39) missense probably damaging 0.98
R8098:Il16 UTSW 7 83,295,767 (GRCm39) missense probably damaging 1.00
R8317:Il16 UTSW 7 83,304,538 (GRCm39) missense probably benign
R8437:Il16 UTSW 7 83,301,351 (GRCm39) missense probably damaging 1.00
R9094:Il16 UTSW 7 83,301,559 (GRCm39) missense probably benign
R9267:Il16 UTSW 7 83,371,757 (GRCm39) missense probably benign 0.01
R9445:Il16 UTSW 7 83,337,380 (GRCm39) nonsense probably null
R9595:Il16 UTSW 7 83,322,273 (GRCm39) nonsense probably null
R9651:Il16 UTSW 7 83,332,064 (GRCm39) missense probably damaging 0.96
Z1176:Il16 UTSW 7 83,302,035 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCCCAGCTAAAATCAGGTGTTAAC -3'
(R):5'- GTTATCTCTGCTTGTGAAAGCC -3'

Sequencing Primer
(F):5'- GTCAAGTGACATGGTGTCCCTC -3'
(R):5'- GCCTTTCAGAGCTGAGAGAATATTC -3'
Posted On 2015-03-18