Incidental Mutation 'R3761:Sh3pxd2b'
ID270541
Institutional Source Beutler Lab
Gene Symbol Sh3pxd2b
Ensembl Gene ENSMUSG00000040711
Gene NameSH3 and PX domains 2B
SynonymsG431001E03Rik, Fad49, Tsk4
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.596) question?
Stock #R3761 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location32347820-32428173 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32422750 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 639 (V639A)
Ref Sequence ENSEMBL: ENSMUSP00000044276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038753]
Predicted Effect probably benign
Transcript: ENSMUST00000038753
AA Change: V639A

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000044276
Gene: ENSMUSG00000040711
AA Change: V639A

DomainStartEndE-ValueType
PX 5 125 2.65e-30 SMART
SH3 155 210 1.11e-14 SMART
SH3 224 279 3.78e-17 SMART
SH3 371 426 2.33e-8 SMART
low complexity region 525 540 N/A INTRINSIC
low complexity region 748 772 N/A INTRINSIC
SH3 850 908 5.75e-8 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adapter protein that is characterized by a PX domain and four Src homology 3 domains. The encoded protein is required for podosome formation and is involved in cell adhesion and migration of numerous cell types. Mutations in this gene are the cause of Frank-ter Haar syndrome (FTHS), and also Borrone Dermato-Cardio-Skeletal (BDCS) syndrome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit abnormal craniofacial morphology, decreased bone density, impaired hearing secondary to otis media, reduced growth, size, and weight, and decreased white adipose tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2cl A G 9: 110,898,134 T923A probably damaging Het
Ccdc91 A T 6: 147,562,702 D216V unknown Het
Clstn3 A G 6: 124,457,876 V360A possibly damaging Het
Ehmt2 A G 17: 34,913,731 I1235V probably damaging Het
Eif3e C T 15: 43,261,084 R346H probably damaging Het
Esrp2 T C 8: 106,133,622 D301G probably damaging Het
Fam174a G T 1: 95,314,246 V144F probably damaging Het
Fbxo31 A T 8: 121,560,430 W135R possibly damaging Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Heatr5b A G 17: 78,829,642 S150P probably damaging Het
Il16 A G 7: 83,650,885 L400S possibly damaging Het
Olfr934 A T 9: 38,982,366 I226N possibly damaging Het
Ryr3 A G 2: 112,754,913 F2776S probably benign Het
Sema3d T C 5: 12,571,037 Y537H probably damaging Het
Slc39a10 A G 1: 46,812,125 V735A possibly damaging Het
Slc45a2 T A 15: 11,012,714 Y268N probably benign Het
Tmco5 A G 2: 116,887,306 probably null Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Wwp1 A T 4: 19,631,085 H649Q probably damaging Het
Other mutations in Sh3pxd2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Sh3pxd2b APN 11 32403993 nonsense probably null
IGL01581:Sh3pxd2b APN 11 32387973 missense possibly damaging 0.64
IGL02067:Sh3pxd2b APN 11 32423095 missense probably benign 0.01
IGL02412:Sh3pxd2b APN 11 32387992 missense probably damaging 0.99
IGL02930:Sh3pxd2b APN 11 32417161 missense possibly damaging 0.91
IGL03299:Sh3pxd2b APN 11 32411448 splice site probably benign
IGL03378:Sh3pxd2b APN 11 32381443 missense probably damaging 1.00
FR4449:Sh3pxd2b UTSW 11 32423065 small insertion probably benign
FR4548:Sh3pxd2b UTSW 11 32423064 small insertion probably benign
FR4548:Sh3pxd2b UTSW 11 32423065 small insertion probably benign
FR4976:Sh3pxd2b UTSW 11 32423055 small insertion probably benign
FR4976:Sh3pxd2b UTSW 11 32423060 small insertion probably benign
R0097:Sh3pxd2b UTSW 11 32403978 missense probably damaging 1.00
R0097:Sh3pxd2b UTSW 11 32403978 missense probably damaging 1.00
R0441:Sh3pxd2b UTSW 11 32423023 missense possibly damaging 0.77
R0715:Sh3pxd2b UTSW 11 32423341 missense possibly damaging 0.93
R1456:Sh3pxd2b UTSW 11 32415967 missense probably damaging 1.00
R1616:Sh3pxd2b UTSW 11 32381441 missense possibly damaging 0.90
R1748:Sh3pxd2b UTSW 11 32422203 missense possibly damaging 0.92
R1902:Sh3pxd2b UTSW 11 32423559 makesense probably null
R1977:Sh3pxd2b UTSW 11 32422138 missense probably damaging 1.00
R3850:Sh3pxd2b UTSW 11 32411505 missense probably damaging 1.00
R4060:Sh3pxd2b UTSW 11 32422263 missense probably benign 0.16
R4062:Sh3pxd2b UTSW 11 32422263 missense probably benign 0.16
R4064:Sh3pxd2b UTSW 11 32422263 missense probably benign 0.16
R4585:Sh3pxd2b UTSW 11 32396479 missense possibly damaging 0.84
R5278:Sh3pxd2b UTSW 11 32381447 missense probably damaging 1.00
R5652:Sh3pxd2b UTSW 11 32422812 missense probably damaging 1.00
R5827:Sh3pxd2b UTSW 11 32422422 missense probably benign 0.01
R5994:Sh3pxd2b UTSW 11 32407570 missense probably damaging 1.00
R6083:Sh3pxd2b UTSW 11 32422985 missense probably benign 0.30
R6392:Sh3pxd2b UTSW 11 32423302 missense possibly damaging 0.74
R6625:Sh3pxd2b UTSW 11 32422594 missense possibly damaging 0.74
R6649:Sh3pxd2b UTSW 11 32415978 splice site probably null
X0017:Sh3pxd2b UTSW 11 32414359 missense possibly damaging 0.94
X0028:Sh3pxd2b UTSW 11 32423110 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGACAAGAGCAAGTTCCCGC -3'
(R):5'- TTTGGACTCAGCCCATCCTG -3'

Sequencing Primer
(F):5'- TTCCCGCTGAGAAATGACATG -3'
(R):5'- AGACCTGTCCTGGCCATG -3'
Posted On2015-03-18