Mutagenetix > Incidental Mutation

Incidental Mutation 'R3761:Sh3pxd2b'

270541

Institutional Source

Beutler Lab

Gene Symbol

Sh3pxd2b

Ensembl Gene

ENSMUSG00000040711

Gene Name

SH3 and PX domains 2B

Synonyms

Tks4, Fad49, G431001E03Rik

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.348) question?

Stock #

R3761 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32297820-32378173 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 32372750 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 639 (V639A)

Ref Sequence

ENSEMBL: ENSMUSP00000044276 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038753]

AlphaFold

A2AAY5

Predicted Effect

probably benign
Transcript: ENSMUST00000038753
AA Change: V639A

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000044276
Gene: ENSMUSG00000040711
AA Change: V639A

Domain	Start	End	E-Value	Type
PX	5	125	2.65e-30	SMART
SH3	155	210	1.11e-14	SMART
SH3	224	279	3.78e-17	SMART
SH3	371	426	2.33e-8	SMART
low complexity region	525	540	N/A	INTRINSIC
low complexity region	748	772	N/A	INTRINSIC
SH3	850	908	5.75e-8	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adapter protein that is characterized by a PX domain and four Src homology 3 domains. The encoded protein is required for podosome formation and is involved in cell adhesion and migration of numerous cell types. Mutations in this gene are the cause of Frank-ter Haar syndrome (FTHS), and also Borrone Dermato-Cardio-Skeletal (BDCS) syndrome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit abnormal craniofacial morphology, decreased bone density, impaired hearing secondary to otis media, reduced growth, size, and weight, and decreased white adipose tissue. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Als2cl	A	G	9: 110,727,202 (GRCm39)	T923A	probably damaging	Het
Ccdc91	A	T	6: 147,464,200 (GRCm39)	D216V	unknown	Het
Clstn3	A	G	6: 124,434,835 (GRCm39)	V360A	possibly damaging	Het
Ct45a	C	T	X: 55,590,568 (GRCm39)	V78I	probably benign	Het
Ehmt2	A	G	17: 35,132,707 (GRCm39)	I1235V	probably damaging	Het
Eif3e	C	T	15: 43,124,480 (GRCm39)	R346H	probably damaging	Het
Esrp2	T	C	8: 106,860,254 (GRCm39)	D301G	probably damaging	Het
Fam174a	G	T	1: 95,241,971 (GRCm39)	V144F	probably damaging	Het
Fbxo31	A	T	8: 122,287,169 (GRCm39)	W135R	possibly damaging	Het
Heatr5b	A	G	17: 79,137,071 (GRCm39)	S150P	probably damaging	Het
Il16	A	G	7: 83,300,093 (GRCm39)	L400S	possibly damaging	Het
Or10d1c	A	T	9: 38,893,662 (GRCm39)	I226N	possibly damaging	Het
Ryr3	A	G	2: 112,585,258 (GRCm39)	F2776S	probably benign	Het
Sema3d	T	C	5: 12,621,004 (GRCm39)	Y537H	probably damaging	Het
Slc39a10	A	G	1: 46,851,285 (GRCm39)	V735A	possibly damaging	Het
Slc45a2	T	A	15: 11,012,800 (GRCm39)	Y268N	probably benign	Het
Tmco5	A	G	2: 116,717,787 (GRCm39)		probably null	Het
Ulk1	C	T	5: 110,937,223 (GRCm39)	R691Q	probably benign	Het
Wwp1	A	T	4: 19,631,085 (GRCm39)	H649Q	probably damaging	Het

Other mutations in Sh3pxd2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01017:Sh3pxd2b	APN	11	32,353,993 (GRCm39)	nonsense	probably null
IGL01581:Sh3pxd2b	APN	11	32,337,973 (GRCm39)	missense	possibly damaging	0.64
IGL02067:Sh3pxd2b	APN	11	32,373,095 (GRCm39)	missense	probably benign	0.01
IGL02412:Sh3pxd2b	APN	11	32,337,992 (GRCm39)	missense	probably damaging	0.99
IGL02930:Sh3pxd2b	APN	11	32,367,161 (GRCm39)	missense	possibly damaging	0.91
IGL03299:Sh3pxd2b	APN	11	32,361,448 (GRCm39)	splice site	probably benign
IGL03378:Sh3pxd2b	APN	11	32,331,443 (GRCm39)	missense	probably damaging	1.00
FR4449:Sh3pxd2b	UTSW	11	32,373,065 (GRCm39)	small insertion	probably benign
FR4548:Sh3pxd2b	UTSW	11	32,373,065 (GRCm39)	small insertion	probably benign
FR4548:Sh3pxd2b	UTSW	11	32,373,064 (GRCm39)	small insertion	probably benign
FR4976:Sh3pxd2b	UTSW	11	32,373,060 (GRCm39)	small insertion	probably benign
FR4976:Sh3pxd2b	UTSW	11	32,373,055 (GRCm39)	small insertion	probably benign
R0097:Sh3pxd2b	UTSW	11	32,353,978 (GRCm39)	missense	probably damaging	1.00
R0097:Sh3pxd2b	UTSW	11	32,353,978 (GRCm39)	missense	probably damaging	1.00
R0441:Sh3pxd2b	UTSW	11	32,373,023 (GRCm39)	missense	possibly damaging	0.77
R0715:Sh3pxd2b	UTSW	11	32,373,341 (GRCm39)	missense	possibly damaging	0.93
R1456:Sh3pxd2b	UTSW	11	32,365,967 (GRCm39)	missense	probably damaging	1.00
R1616:Sh3pxd2b	UTSW	11	32,331,441 (GRCm39)	missense	possibly damaging	0.90
R1748:Sh3pxd2b	UTSW	11	32,372,203 (GRCm39)	missense	possibly damaging	0.92
R1902:Sh3pxd2b	UTSW	11	32,373,559 (GRCm39)	makesense	probably null
R1977:Sh3pxd2b	UTSW	11	32,372,138 (GRCm39)	missense	probably damaging	1.00
R3850:Sh3pxd2b	UTSW	11	32,361,505 (GRCm39)	missense	probably damaging	1.00
R4060:Sh3pxd2b	UTSW	11	32,372,263 (GRCm39)	missense	probably benign	0.16
R4062:Sh3pxd2b	UTSW	11	32,372,263 (GRCm39)	missense	probably benign	0.16
R4064:Sh3pxd2b	UTSW	11	32,372,263 (GRCm39)	missense	probably benign	0.16
R4585:Sh3pxd2b	UTSW	11	32,346,479 (GRCm39)	missense	possibly damaging	0.84
R5278:Sh3pxd2b	UTSW	11	32,331,447 (GRCm39)	missense	probably damaging	1.00
R5652:Sh3pxd2b	UTSW	11	32,372,812 (GRCm39)	missense	probably damaging	1.00
R5827:Sh3pxd2b	UTSW	11	32,372,422 (GRCm39)	missense	probably benign	0.01
R5994:Sh3pxd2b	UTSW	11	32,357,570 (GRCm39)	missense	probably damaging	1.00
R6083:Sh3pxd2b	UTSW	11	32,372,985 (GRCm39)	missense	probably benign	0.30
R6392:Sh3pxd2b	UTSW	11	32,373,302 (GRCm39)	missense	possibly damaging	0.74
R6625:Sh3pxd2b	UTSW	11	32,372,594 (GRCm39)	missense	possibly damaging	0.74
R6649:Sh3pxd2b	UTSW	11	32,365,978 (GRCm39)	splice site	probably null
R7056:Sh3pxd2b	UTSW	11	32,372,737 (GRCm39)	missense	probably benign	0.01
R7131:Sh3pxd2b	UTSW	11	32,372,072 (GRCm39)	missense	probably damaging	1.00
R7192:Sh3pxd2b	UTSW	11	32,364,318 (GRCm39)	missense	probably damaging	1.00
R7911:Sh3pxd2b	UTSW	11	32,321,533 (GRCm39)	missense	probably damaging	1.00
R8026:Sh3pxd2b	UTSW	11	32,361,567 (GRCm39)	missense	probably damaging	1.00
R8027:Sh3pxd2b	UTSW	11	32,372,210 (GRCm39)	missense	probably benign	0.01
R8555:Sh3pxd2b	UTSW	11	32,361,469 (GRCm39)	missense	probably benign	0.34
R8939:Sh3pxd2b	UTSW	11	32,364,433 (GRCm39)	splice site	probably benign
R9003:Sh3pxd2b	UTSW	11	32,361,571 (GRCm39)	missense	probably damaging	0.96
R9090:Sh3pxd2b	UTSW	11	32,373,361 (GRCm39)	missense	possibly damaging	0.90
R9271:Sh3pxd2b	UTSW	11	32,373,361 (GRCm39)	missense	possibly damaging	0.90
RF016:Sh3pxd2b	UTSW	11	32,373,053 (GRCm39)	small insertion	probably benign
RF022:Sh3pxd2b	UTSW	11	32,373,054 (GRCm39)	small insertion	probably benign
RF025:Sh3pxd2b	UTSW	11	32,373,057 (GRCm39)	small insertion	probably benign
RF040:Sh3pxd2b	UTSW	11	32,373,055 (GRCm39)	small insertion	probably benign
RF056:Sh3pxd2b	UTSW	11	32,373,055 (GRCm39)	small insertion	probably benign
RF063:Sh3pxd2b	UTSW	11	32,373,051 (GRCm39)	small insertion	probably benign
X0017:Sh3pxd2b	UTSW	11	32,364,359 (GRCm39)	missense	possibly damaging	0.94
X0028:Sh3pxd2b	UTSW	11	32,373,110 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTGACAAGAGCAAGTTCCCGC -3'
(R):5'- TTTGGACTCAGCCCATCCTG -3'

Sequencing Primer
(F):5'- TTCCCGCTGAGAAATGACATG -3'
(R):5'- AGACCTGTCCTGGCCATG -3'

Posted On

2015-03-18