Incidental Mutation 'R3763:Slc44a1'
ID270584
Institutional Source Beutler Lab
Gene Symbol Slc44a1
Ensembl Gene ENSMUSG00000028412
Gene Namesolute carrier family 44, member 1
SynonymsCdw92, 4833416H08Rik, CHTL1, CTL1, 2210409B22Rik
MMRRC Submission 040873-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3763 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location53440413-53622478 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53563286 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 671 (V671A)
Ref Sequence ENSEMBL: ENSMUSP00000103274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102911] [ENSMUST00000107645] [ENSMUST00000107647] [ENSMUST00000107651]
Predicted Effect probably benign
Transcript: ENSMUST00000102911
SMART Domains Protein: ENSMUSP00000099975
Gene: ENSMUSG00000028412

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
Pfam:Choline_transpo 290 610 2.4e-107 PFAM
low complexity region 630 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107645
SMART Domains Protein: ENSMUSP00000103272
Gene: ENSMUSG00000028412

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 33 55 N/A INTRINSIC
Pfam:Choline_transpo 83 403 4.8e-108 PFAM
low complexity region 423 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107647
AA Change: V671A

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103274
Gene: ENSMUSG00000028412
AA Change: V671A

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
Pfam:Choline_transpo 292 607 1.8e-105 PFAM
low complexity region 630 643 N/A INTRINSIC
transmembrane domain 682 704 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107651
SMART Domains Protein: ENSMUSP00000103278
Gene: ENSMUSG00000028412

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
Pfam:Choline_transpo 290 610 3.5e-108 PFAM
low complexity region 630 643 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138377
Meta Mutation Damage Score 0.1152 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a A G 2: 48,870,319 E29G possibly damaging Het
Aff3 A G 1: 38,252,689 probably benign Het
AW146154 A G 7: 41,480,370 C441R probably damaging Het
Cacna1a T C 8: 84,583,642 V1443A possibly damaging Het
Commd1 T A 11: 22,974,102 F292Y probably benign Het
Ddx18 A G 1: 121,561,377 Y314H probably damaging Het
Dna2 C T 10: 62,966,797 T898I probably damaging Het
Epc1 C A 18: 6,440,091 V59L possibly damaging Het
Etv6 C A 6: 134,263,012 probably benign Het
Fam118a A G 15: 85,053,797 D293G possibly damaging Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gzmn A C 14: 56,166,904 S159A probably benign Het
Insc A G 7: 114,790,972 D26G probably damaging Het
L1td1 A G 4: 98,737,835 R756G probably damaging Het
Ltk A G 2: 119,751,837 L499P probably benign Het
Mast4 A T 13: 102,787,419 L291M probably damaging Het
Nefm G T 14: 68,124,348 R156S probably damaging Het
Nppc T A 1: 86,669,858 N63Y probably damaging Het
Olfr507 A T 7: 108,622,717 I302F probably damaging Het
Olfr816 A G 10: 129,911,445 S278P probably damaging Het
Pcdhb7 T C 18: 37,341,883 V24A probably benign Het
Pcm1 C A 8: 41,280,077 Q787K probably damaging Het
Prg3 A G 2: 84,992,990 K170E possibly damaging Het
Slc25a54 T C 3: 109,112,054 S325P probably damaging Het
Spock3 T A 8: 63,144,015 probably null Het
Stk-ps2 G A 1: 46,029,921 noncoding transcript Het
Svep1 T G 4: 58,084,833 D1835A possibly damaging Het
Tmcc3 A G 10: 94,579,317 T294A probably benign Het
Tsen54 A G 11: 115,820,411 N62S probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn2r18 G A 5: 151,585,179 A160V probably damaging Het
Wnk4 T C 11: 101,269,288 V661A probably benign Het
Zfhx4 A G 3: 5,403,344 Y2854C probably damaging Het
Zfp563 G T 17: 33,104,928 E166* probably null Het
Zfp687 T A 3: 95,012,080 N127I probably damaging Het
Zfp958 T A 8: 4,626,226 probably null Het
Other mutations in Slc44a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Slc44a1 APN 4 53543571 missense probably damaging 1.00
IGL00420:Slc44a1 APN 4 53553550 missense possibly damaging 0.86
IGL01369:Slc44a1 APN 4 53491448 missense probably damaging 1.00
IGL01867:Slc44a1 APN 4 53536405 missense probably damaging 1.00
IGL02188:Slc44a1 APN 4 53541361 missense probably benign 0.01
IGL03095:Slc44a1 APN 4 53536374 nonsense probably null
R0517:Slc44a1 UTSW 4 53542366 missense probably damaging 0.99
R0815:Slc44a1 UTSW 4 53536421 missense possibly damaging 0.77
R1437:Slc44a1 UTSW 4 53561006 missense probably damaging 1.00
R1443:Slc44a1 UTSW 4 53561069 missense probably damaging 1.00
R1673:Slc44a1 UTSW 4 53542468 missense probably benign 0.04
R2037:Slc44a1 UTSW 4 53563243 intron probably benign
R2131:Slc44a1 UTSW 4 53563246 frame shift probably null
R3417:Slc44a1 UTSW 4 53553549 missense probably benign 0.04
R3721:Slc44a1 UTSW 4 53491445 missense probably damaging 1.00
R4426:Slc44a1 UTSW 4 53563286 missense probably benign 0.45
R4751:Slc44a1 UTSW 4 53560973 missense probably damaging 1.00
R4993:Slc44a1 UTSW 4 53543644 missense probably damaging 1.00
R5853:Slc44a1 UTSW 4 53528682 missense probably benign 0.00
R6293:Slc44a1 UTSW 4 53561099 missense probably damaging 1.00
R6978:Slc44a1 UTSW 4 53544671 missense probably damaging 1.00
R7164:Slc44a1 UTSW 4 53528711 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCAGTTAATGCCGTGCACTC -3'
(R):5'- CTGACAGCAAGAAAACCAGCTTTG -3'

Sequencing Primer
(F):5'- GCACTCCATGTTTTGCAGGAG -3'
(R):5'- AACCAGCTTTGACTCGGAG -3'
Posted On2015-03-18