Incidental Mutation 'R3724:Kat6a'
ID270678
Institutional Source Beutler Lab
Gene Symbol Kat6a
Ensembl Gene ENSMUSG00000031540
Gene NameK(lysine) acetyltransferase 6A
SynonymsZfp220, MOZ, 9930021N24Rik, Myst3
MMRRC Submission 040715-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3724 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location22859535-22943259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22862788 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 196 (H196L)
Ref Sequence ENSEMBL: ENSMUSP00000106324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044331] [ENSMUST00000110696]
Predicted Effect probably damaging
Transcript: ENSMUST00000044331
AA Change: H196L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038181
Gene: ENSMUSG00000031540
AA Change: H196L

DomainStartEndE-ValueType
H15 85 165 1.88e-5 SMART
low complexity region 184 195 N/A INTRINSIC
PHD 208 263 1.7e-7 SMART
RING 209 262 1.28e0 SMART
PHD 264 311 9.84e-13 SMART
RING 265 310 4.15e0 SMART
low complexity region 371 378 N/A INTRINSIC
Pfam:MOZ_SAS 561 748 5.9e-92 PFAM
low complexity region 787 800 N/A INTRINSIC
low complexity region 985 1003 N/A INTRINSIC
low complexity region 1011 1029 N/A INTRINSIC
low complexity region 1031 1044 N/A INTRINSIC
low complexity region 1066 1079 N/A INTRINSIC
low complexity region 1149 1162 N/A INTRINSIC
low complexity region 1224 1238 N/A INTRINSIC
low complexity region 1257 1273 N/A INTRINSIC
coiled coil region 1278 1308 N/A INTRINSIC
low complexity region 1397 1409 N/A INTRINSIC
low complexity region 1471 1490 N/A INTRINSIC
low complexity region 1528 1542 N/A INTRINSIC
low complexity region 1569 1597 N/A INTRINSIC
low complexity region 1641 1700 N/A INTRINSIC
low complexity region 1802 1813 N/A INTRINSIC
low complexity region 1950 1958 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110696
AA Change: H196L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106324
Gene: ENSMUSG00000031540
AA Change: H196L

DomainStartEndE-ValueType
H15 85 165 1.88e-5 SMART
low complexity region 184 195 N/A INTRINSIC
PHD 208 263 1.7e-7 SMART
RING 209 262 1.28e0 SMART
PHD 264 311 9.84e-13 SMART
RING 265 310 4.15e0 SMART
low complexity region 371 378 N/A INTRINSIC
Pfam:MOZ_SAS 564 742 2.9e-85 PFAM
low complexity region 787 800 N/A INTRINSIC
low complexity region 985 1003 N/A INTRINSIC
low complexity region 1011 1029 N/A INTRINSIC
low complexity region 1031 1044 N/A INTRINSIC
low complexity region 1066 1079 N/A INTRINSIC
low complexity region 1149 1162 N/A INTRINSIC
low complexity region 1224 1238 N/A INTRINSIC
low complexity region 1257 1273 N/A INTRINSIC
coiled coil region 1278 1308 N/A INTRINSIC
low complexity region 1397 1409 N/A INTRINSIC
low complexity region 1471 1490 N/A INTRINSIC
low complexity region 1528 1542 N/A INTRINSIC
low complexity region 1569 1597 N/A INTRINSIC
low complexity region 1641 1700 N/A INTRINSIC
low complexity region 1802 1813 N/A INTRINSIC
low complexity region 1950 1958 N/A INTRINSIC
Meta Mutation Damage Score 0.346 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the MOZ, YBFR2, SAS2, TIP60 family of histone acetyltransferases. The protein is composed of a nuclear localization domain, a double C2H2 zinc finger domain that binds to acetylated histone tails, a histone acetyl-transferase domain, a glutamate/aspartate-rich region, and a serine- and methionine-rich transactivation domain. It is part of a complex that acetylates lysine-9 residues in histone 3, and in addition, it acts as a co-activator for several transcription factors. Allelic variants of this gene are associated with autosomal dominant mental retardation-32. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous null mice display perinatal lethality, cyanosis, decreased hematopoietic progenitor cell numbers, and severely impaired spleen and thymus development, but are not anemic. Heterozygotes display strain background dependent reductions in fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G T 8: 120,149,360 R133L probably damaging Het
Abhd8 G A 8: 71,461,492 A164V probably benign Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Atl1 A G 12: 69,959,380 T487A probably damaging Het
C2cd6 C T 1: 59,066,235 probably benign Het
Ccdc88c G A 12: 100,930,524 A1389V possibly damaging Het
Ccna1 T C 3: 55,050,932 E110G probably damaging Het
Ccne2 T C 4: 11,203,039 C386R probably benign Het
Cfap53 A G 18: 74,359,569 I455V probably benign Het
Ctdp1 C T 18: 80,459,267 V143I probably benign Het
Cyp11a1 A T 9: 58,019,322 M47L probably benign Het
Dnah5 T C 15: 28,270,420 L956P probably benign Het
Enkd1 A T 8: 105,703,925 V326E possibly damaging Het
Epha4 A G 1: 77,426,543 probably benign Het
Etv5 T C 16: 22,435,912 D66G probably damaging Het
Evi5l A G 8: 4,178,080 probably benign Het
Foxf2 A G 13: 31,630,530 K409R probably damaging Het
Frem3 A G 8: 80,615,271 T1398A probably benign Het
Galm A G 17: 80,183,280 T289A probably benign Het
Gtdc1 T C 2: 44,756,307 E44G probably damaging Het
Hmcn1 T A 1: 150,689,518 Y2286F possibly damaging Het
Iars A G 13: 49,687,384 probably null Het
Ifna5 A G 4: 88,835,934 E137G probably damaging Het
Itih4 G A 14: 30,892,584 E468K possibly damaging Het
Kctd16 A G 18: 40,258,859 T167A possibly damaging Het
Klhl29 C T 12: 5,090,603 V680I probably damaging Het
March7 T C 2: 60,229,745 I72T probably benign Het
Mbd6 C T 10: 127,283,891 probably benign Het
Mefv A G 16: 3,708,194 probably null Het
Mindy3 T A 2: 12,355,354 M6L probably damaging Het
Mrpl9 T A 3: 94,447,766 probably null Het
Nlrp4e A T 7: 23,321,377 T430S probably benign Het
Olfr1187-ps1 T G 2: 88,540,286 noncoding transcript Het
Pcdh15 A T 10: 74,645,848 T342S probably benign Het
Prkce A T 17: 86,168,623 K11* probably null Het
Pros1 T C 16: 62,900,329 I117T possibly damaging Het
Prpf38b T C 3: 108,904,340 probably benign Het
Sh3rf1 T C 8: 61,372,722 S584P probably benign Het
Slit2 T C 5: 48,256,883 probably null Het
Srsf4 C T 4: 131,900,102 probably benign Het
Stambp C T 6: 83,557,466 E280K probably damaging Het
Tenm3 A G 8: 48,277,746 I1329T probably damaging Het
Tex2 G A 11: 106,529,330 T869I unknown Het
Tlk2 A G 11: 105,247,564 T281A probably benign Het
Tpm1 G A 9: 67,031,945 probably benign Het
Trim3 A G 7: 105,611,189 F702L probably damaging Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Vmn2r20 T A 6: 123,385,747 T693S probably benign Het
Zfand2b A G 1: 75,169,855 K125E possibly damaging Het
Zfp422 C T 6: 116,626,379 A220T probably benign Het
Zfp747 A T 7: 127,374,590 V136D probably benign Het
Other mutations in Kat6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Kat6a APN 8 22940263 missense unknown
IGL01093:Kat6a APN 8 22939321 missense possibly damaging 0.85
IGL01364:Kat6a APN 8 22907700 missense probably damaging 1.00
IGL01868:Kat6a APN 8 22926455 missense probably damaging 1.00
IGL02477:Kat6a APN 8 22929300 missense probably damaging 1.00
IGL02792:Kat6a APN 8 22938300 missense probably damaging 0.98
IGL03243:Kat6a APN 8 22910222 missense possibly damaging 0.77
Anning UTSW 8 22932113 critical splice acceptor site probably null
lord UTSW 8 22862364 missense probably damaging 1.00
master UTSW 8 22862788 missense probably damaging 0.99
R0018:Kat6a UTSW 8 22929273 missense possibly damaging 0.74
R0018:Kat6a UTSW 8 22929273 missense possibly damaging 0.74
R0284:Kat6a UTSW 8 22939803 missense unknown
R0636:Kat6a UTSW 8 22939323 missense possibly damaging 0.73
R0883:Kat6a UTSW 8 22862214 missense probably damaging 1.00
R1457:Kat6a UTSW 8 22938652 missense probably benign
R1753:Kat6a UTSW 8 22935797 missense probably benign 0.09
R2059:Kat6a UTSW 8 22939305 missense possibly damaging 0.53
R2155:Kat6a UTSW 8 22935647 small deletion probably benign
R2764:Kat6a UTSW 8 22932178 missense probably damaging 1.00
R3824:Kat6a UTSW 8 22862364 missense probably damaging 1.00
R3825:Kat6a UTSW 8 22862364 missense probably damaging 1.00
R4370:Kat6a UTSW 8 22911929 missense possibly damaging 0.95
R4371:Kat6a UTSW 8 22911929 missense possibly damaging 0.95
R4457:Kat6a UTSW 8 22932113 critical splice acceptor site probably null
R4600:Kat6a UTSW 8 22939311 missense probably benign 0.18
R4792:Kat6a UTSW 8 22940576 missense unknown
R4896:Kat6a UTSW 8 22938313 missense probably benign 0.07
R5069:Kat6a UTSW 8 22903133 missense probably damaging 1.00
R5192:Kat6a UTSW 8 22911713 missense probably damaging 0.99
R5196:Kat6a UTSW 8 22911713 missense probably damaging 0.99
R5279:Kat6a UTSW 8 22939648 small deletion probably benign
R5331:Kat6a UTSW 8 22939984 missense unknown
R5480:Kat6a UTSW 8 22938307 missense possibly damaging 0.77
R5659:Kat6a UTSW 8 22938160 nonsense probably null
R5759:Kat6a UTSW 8 22938012 missense probably benign 0.04
R5787:Kat6a UTSW 8 22932647 missense probably damaging 0.99
R5892:Kat6a UTSW 8 22938289 missense probably damaging 1.00
R5923:Kat6a UTSW 8 22939479 missense probably benign 0.00
R6049:Kat6a UTSW 8 22939037 missense possibly damaging 0.53
R6223:Kat6a UTSW 8 22940426 missense unknown
R6276:Kat6a UTSW 8 22939405 missense possibly damaging 0.96
R6279:Kat6a UTSW 8 22939612 missense unknown
R6300:Kat6a UTSW 8 22939612 missense unknown
R6307:Kat6a UTSW 8 22940368 missense unknown
R6562:Kat6a UTSW 8 22911787 missense probably benign 0.04
R6807:Kat6a UTSW 8 22940368 missense unknown
R6852:Kat6a UTSW 8 22938660 missense probably benign 0.18
R6875:Kat6a UTSW 8 22932361 missense probably benign 0.02
R6895:Kat6a UTSW 8 22935783 missense possibly damaging 0.88
R6913:Kat6a UTSW 8 22903199 missense possibly damaging 0.53
R7047:Kat6a UTSW 8 22938538 missense possibly damaging 0.53
R7235:Kat6a UTSW 8 22914269 missense possibly damaging 0.94
R7243:Kat6a UTSW 8 22938775 missense probably benign 0.00
R7454:Kat6a UTSW 8 22935772 missense possibly damaging 0.56
X0050:Kat6a UTSW 8 22940481 nonsense probably null
Z1088:Kat6a UTSW 8 22935501 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCAGAAGGATGTATCTGCTG -3'
(R):5'- CTCTATACTCTGAACAGAAAGCTTC -3'

Sequencing Primer
(F):5'- AGAAGGATGTATCTGCTGCCTGTG -3'
(R):5'- TCTGAACAGAAAGCTTCAAAGAC -3'
Posted On2015-03-18