Incidental Mutation 'R3726:Lonp1'
ID270812
Institutional Source Beutler Lab
Gene Symbol Lonp1
Ensembl Gene ENSMUSG00000041168
Gene Namelon peptidase 1, mitochondrial
Synonyms1200017E13Rik, LON, Prss15
MMRRC Submission 040717-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3726 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location56614301-56626903 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 56618310 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000079340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047226] [ENSMUST00000080492]
Predicted Effect probably benign
Transcript: ENSMUST00000047226
SMART Domains Protein: ENSMUSP00000041814
Gene: ENSMUSG00000041168

DomainStartEndE-ValueType
LON 111 357 3.95e-62 SMART
low complexity region 389 404 N/A INTRINSIC
AAA 504 649 1.81e-14 SMART
Pfam:Lon_C 725 938 1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080492
SMART Domains Protein: ENSMUSP00000079340
Gene: ENSMUSG00000057863

DomainStartEndE-ValueType
Pfam:Ribosomal_L36e 2 100 2.4e-51 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial matrix protein that belongs to the Lon family of ATP-dependent proteases. This protein mediates the selective degradation of misfolded, unassembled or oxidatively damaged polypeptides in the mitochondrial matrix. It may also have a chaperone function in the assembly of inner membrane protein complexes, and participate in the regulation of mitochondrial gene expression and maintenance of the integrity of the mitochondrial genome. Decreased expression of this gene has been noted in a patient with hereditary spastic paraplegia (PMID:18378094). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality with embryonic growth retardation, small size and decreased mitochondrial DNA content. Mice heterozygous for this allele exhibit reduced chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402K13Rik AGAGGAG AGAG X: 9,105,103 probably benign Het
Caap1 A T 4: 94,501,143 V318D probably damaging Het
Camsap3 T C 8: 3,603,785 L485P probably damaging Het
Ccsap T C 8: 123,859,361 E17G possibly damaging Het
Cdk5rap2 C A 4: 70,235,437 K1716N possibly damaging Het
Coq3 T C 4: 21,892,941 probably benign Het
Daam2 T A 17: 49,469,738 D773V probably damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fam209 T C 2: 172,473,995 S97P probably benign Het
Fam50b G A 13: 34,746,886 R115H probably damaging Het
Fbxo31 A G 8: 121,578,509 F83L probably damaging Het
Fsip2 G T 2: 82,988,967 A5015S possibly damaging Het
Galnt13 A G 2: 55,098,657 H497R probably damaging Het
Ggnbp2 A G 11: 84,854,094 C201R possibly damaging Het
Gm8730 T C 8: 102,865,032 noncoding transcript Het
Gsr A G 8: 33,671,537 K124R probably benign Het
Hdgf T C 3: 87,914,497 S140P probably benign Het
Iqcg C T 16: 33,029,041 E292K probably damaging Het
Lamb1 C T 12: 31,321,075 A1375V probably null Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr805 A T 10: 129,723,115 V143D probably damaging Het
Pcdhb9 T C 18: 37,401,601 L216P possibly damaging Het
Ppp3cb A G 14: 20,530,942 probably null Het
Ptprm G A 17: 66,956,860 P464L possibly damaging Het
Rars2 A G 4: 34,645,787 T235A probably benign Het
Rimkla A T 4: 119,477,789 probably null Het
Rnf216 A T 5: 143,027,946 I708N probably damaging Het
Six5 T A 7: 19,096,930 V494E possibly damaging Het
Slc43a2 A G 11: 75,543,154 probably benign Het
Slmap C A 14: 26,427,242 R671S probably damaging Het
Smarcal1 T C 1: 72,626,596 F751S possibly damaging Het
Sptan1 G A 2: 30,018,419 D1711N possibly damaging Het
Sptssa T C 12: 54,656,395 E30G probably damaging Het
Taf1c A G 8: 119,603,070 F111L probably damaging Het
Thbs1 A G 2: 118,114,710 I255V probably benign Het
Tmem19 A G 10: 115,359,770 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmod1 T C 4: 46,097,026 V273A probably benign Het
Trpm8 A T 1: 88,328,196 Y191F probably benign Het
Ube4a T C 9: 44,933,323 I934V probably damaging Het
Vpreb3 G A 10: 75,943,291 probably null Het
Vwf G T 6: 125,677,948 probably benign Het
Wdr53 T C 16: 32,256,720 C248R probably benign Het
Zfp217 A G 2: 170,119,210 V399A probably damaging Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Lonp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Lonp1 APN 17 56619265 missense probably damaging 1.00
IGL00934:Lonp1 APN 17 56614683 missense probably benign 0.21
IGL01065:Lonp1 APN 17 56615500 unclassified probably benign
IGL01343:Lonp1 APN 17 56615586 missense possibly damaging 0.93
IGL01734:Lonp1 APN 17 56616026 missense probably damaging 1.00
IGL02141:Lonp1 APN 17 56615086 missense probably benign 0.19
IGL02979:Lonp1 APN 17 56621940 missense probably benign 0.02
R0015:Lonp1 UTSW 17 56618406 missense probably benign
R0015:Lonp1 UTSW 17 56618406 missense probably benign
R0863:Lonp1 UTSW 17 56618331 missense probably damaging 1.00
R1343:Lonp1 UTSW 17 56620272 missense probably damaging 1.00
R1735:Lonp1 UTSW 17 56614956 missense probably damaging 1.00
R1975:Lonp1 UTSW 17 56615068 missense possibly damaging 0.69
R1976:Lonp1 UTSW 17 56615068 missense possibly damaging 0.69
R1977:Lonp1 UTSW 17 56615068 missense possibly damaging 0.69
R2484:Lonp1 UTSW 17 56614659 missense probably damaging 1.00
R2895:Lonp1 UTSW 17 56615562 missense probably damaging 1.00
R3123:Lonp1 UTSW 17 56626488 missense possibly damaging 0.79
R3125:Lonp1 UTSW 17 56626488 missense possibly damaging 0.79
R3429:Lonp1 UTSW 17 56618337 missense probably damaging 1.00
R3767:Lonp1 UTSW 17 56621952 missense possibly damaging 0.80
R4618:Lonp1 UTSW 17 56622511 missense probably benign 0.03
R4859:Lonp1 UTSW 17 56626587 missense probably benign 0.00
R4951:Lonp1 UTSW 17 56620335 missense possibly damaging 0.64
R5208:Lonp1 UTSW 17 56617793 missense probably damaging 1.00
R5620:Lonp1 UTSW 17 56620263 missense probably benign 0.05
R5621:Lonp1 UTSW 17 56620263 missense probably benign 0.05
R5622:Lonp1 UTSW 17 56620263 missense probably benign 0.05
R6131:Lonp1 UTSW 17 56614457 missense probably benign 0.01
R6377:Lonp1 UTSW 17 56621961 missense possibly damaging 0.90
R6692:Lonp1 UTSW 17 56619230 missense probably damaging 1.00
R7052:Lonp1 UTSW 17 56626549 missense probably benign 0.31
R7131:Lonp1 UTSW 17 56617814 missense probably damaging 1.00
R7295:Lonp1 UTSW 17 56622495 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- AATCATGTTAGGGGCCCCTC -3'
(R):5'- CACTGCATCACTAGGAGCATTTG -3'

Sequencing Primer
(F):5'- GTTAGGGGCCCCTCTTCCATAG -3'
(R):5'- GCATCACTAGGAGCATTTGGTCAC -3'
Posted On2015-03-18