Incidental Mutation 'R3727:Nfix'
ID270836
Institutional Source Beutler Lab
Gene Symbol Nfix
Ensembl Gene ENSMUSG00000001911
Gene Namenuclear factor I/X
Synonyms
MMRRC Submission 040718-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.330) question?
Stock #R3727 (G1)
Quality Score104
Status Validated
Chromosome8
Chromosomal Location84699876-84800344 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CAAAAA to CAAAA at 84716247 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076715] [ENSMUST00000099070] [ENSMUST00000109762] [ENSMUST00000109764] [ENSMUST00000126806]
Predicted Effect probably benign
Transcript: ENSMUST00000076715
SMART Domains Protein: ENSMUSP00000076005
Gene: ENSMUSG00000001911

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 4.1e-30 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 322 7.4e-32 PFAM
Pfam:CTF_NFI 313 396 3.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099070
SMART Domains Protein: ENSMUSP00000096669
Gene: ENSMUSG00000001911

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 4.7e-30 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 437 2.7e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109762
SMART Domains Protein: ENSMUSP00000105384
Gene: ENSMUSG00000001911

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1.1e-27 PFAM
DWA 59 167 1.86e-18 SMART
low complexity region 180 191 N/A INTRINSIC
Pfam:CTF_NFI 205 312 5.4e-32 PFAM
Pfam:CTF_NFI 305 387 3.6e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109764
SMART Domains Protein: ENSMUSP00000105386
Gene: ENSMUSG00000001911

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1e-28 PFAM
DWA 59 167 1.86e-18 SMART
low complexity region 180 191 N/A INTRINSIC
Pfam:CTF_NFI 205 494 9.8e-137 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000126806
SMART Domains Protein: ENSMUSP00000115691
Gene: ENSMUSG00000001911

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 7.1e-31 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 488 1.5e-83 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132236
Meta Mutation Damage Score 0.6232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral and cellular promoters. The encoded protein can also stimulate adenovirus replication in vitro. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a mutation in this gene display postnatal lethality, hydrocephalus, partial agenesis of the corpus callosum, deformation of the spine due to delayed vertebral body ossification, degeneration of intervertebral disks, decreased mineralization and impaired endochondral ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,113,857 V630M probably damaging Het
Alk T C 17: 71,901,400 probably benign Het
Atp6v0a1 T A 11: 101,030,420 S243T probably benign Het
BC035044 C A 6: 128,890,859 G37* probably null Het
C3 G T 17: 57,207,379 N1435K possibly damaging Het
Caly T C 7: 140,070,504 E175G probably damaging Het
Ccng2 T C 5: 93,274,951 F330S probably damaging Het
Cyp2c38 A G 19: 39,392,295 probably benign Het
Cypt1 T A X: 16,523,435 L128* probably null Het
Dmgdh A G 13: 93,692,067 N239D probably damaging Het
Dnah8 C T 17: 30,739,648 Q2155* probably null Het
Dpp3 A G 19: 4,923,185 I127T probably benign Het
Dusp27 G A 1: 166,099,506 R846C probably damaging Het
Eps15 G T 4: 109,370,685 probably benign Het
Exosc10 A G 4: 148,565,277 D388G probably damaging Het
Flt3 C A 5: 147,354,923 R572S probably damaging Het
Gm44501 T C 17: 40,576,615 F8S unknown Het
Hormad2 C A 11: 4,408,598 G270C probably benign Het
Ifrd2 C T 9: 107,591,682 R40* probably null Het
Ina G A 19: 47,015,719 R322H possibly damaging Het
Kif13b A G 14: 64,765,748 probably benign Het
Lrp2 T C 2: 69,510,429 N1034S probably damaging Het
Macf1 T A 4: 123,459,311 E1770V probably damaging Het
Mpi T C 9: 57,544,849 I381M possibly damaging Het
Nt5c C T 11: 115,490,648 W185* probably null Het
Olfr137 A T 17: 38,305,419 I14N possibly damaging Het
Olfr1391 G A 11: 49,327,795 R128H probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pdzrn3 T A 6: 101,156,945 D441V probably damaging Het
Rab42 A G 4: 132,302,653 M86T probably benign Het
Slc52a3 C T 2: 152,005,781 P270S probably benign Het
Stpg2 T C 3: 139,298,496 F278S probably damaging Het
Tmem2 G A 19: 21,844,711 A1157T probably benign Het
Tmem240 T C 4: 155,739,778 probably benign Het
Vmn2r22 A G 6: 123,650,625 L4P possibly damaging Het
Vmn2r95 C T 17: 18,441,482 Q497* probably null Het
Wnk1 T C 6: 119,992,453 H347R probably damaging Het
Zmym2 A T 14: 56,919,349 probably benign Het
Other mutations in Nfix
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Nfix APN 8 84726477 missense probably damaging 0.99
IGL01919:Nfix APN 8 84726474 missense probably damaging 1.00
IGL01950:Nfix APN 8 84713786 makesense probably null
IGL02862:Nfix APN 8 84713846 missense probably benign 0.07
R0142:Nfix UTSW 8 84721686 missense probably damaging 1.00
R0309:Nfix UTSW 8 84721774 missense probably damaging 1.00
R0600:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0622:Nfix UTSW 8 84726482 missense probably damaging 0.99
R0628:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0882:Nfix UTSW 8 84727925 missense probably damaging 1.00
R0893:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0973:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0973:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0974:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0975:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1014:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1015:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1162:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1241:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1381:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1513:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1521:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1618:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1865:Nfix UTSW 8 84772275 missense possibly damaging 0.73
R1912:Nfix UTSW 8 84721677 missense probably damaging 1.00
R1974:Nfix UTSW 8 84726526 missense probably damaging 1.00
R2208:Nfix UTSW 8 84716247 frame shift probably null
R2251:Nfix UTSW 8 84716170 missense probably benign 0.03
R2268:Nfix UTSW 8 84716247 frame shift probably null
R2270:Nfix UTSW 8 84716247 frame shift probably null
R2272:Nfix UTSW 8 84727175 missense probably damaging 1.00
R2346:Nfix UTSW 8 84716247 frame shift probably null
R2350:Nfix UTSW 8 84716247 frame shift probably null
R2963:Nfix UTSW 8 84716247 frame shift probably null
R2983:Nfix UTSW 8 84716247 frame shift probably null
R3008:Nfix UTSW 8 84716247 frame shift probably null
R3791:Nfix UTSW 8 84716247 frame shift probably null
R4163:Nfix UTSW 8 84716247 frame shift probably null
R4164:Nfix UTSW 8 84716247 frame shift probably null
R4201:Nfix UTSW 8 84716247 frame shift probably null
R4206:Nfix UTSW 8 84716247 frame shift probably null
R4609:Nfix UTSW 8 84726490 missense probably damaging 1.00
R4801:Nfix UTSW 8 84716247 frame shift probably null
R4802:Nfix UTSW 8 84716247 frame shift probably null
R4914:Nfix UTSW 8 84771829 missense probably benign 0.00
R4915:Nfix UTSW 8 84771829 missense probably benign 0.00
R4916:Nfix UTSW 8 84771829 missense probably benign 0.00
R4918:Nfix UTSW 8 84771829 missense probably benign 0.00
R5013:Nfix UTSW 8 84772084 missense possibly damaging 0.86
R5290:Nfix UTSW 8 84713777 nonsense probably null
R6418:Nfix UTSW 8 84727149 missense probably benign 0.01
R6554:Nfix UTSW 8 84727650 missense possibly damaging 0.93
R6786:Nfix UTSW 8 84727647 missense probably damaging 1.00
T0970:Nfix UTSW 8 84726483 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGCTGGCTGGAGTAACTGAG -3'
(R):5'- TCCTGTGCCTAGAGGAAAGG -3'

Sequencing Primer
(F):5'- CCTCTCTTTGCAGTGGAGAC -3'
(R):5'- GAGGAAAGGACCCTCCCTC -3'
Posted On2015-03-18