Incidental Mutation 'R3727:Atp6v0a1'
ID270841
Institutional Source Beutler Lab
Gene Symbol Atp6v0a1
Ensembl Gene ENSMUSG00000019302
Gene NameATPase, H+ transporting, lysosomal V0 subunit A1
SynonymsAtp6n1a, Vpp-1, Vpp1, V-ATPase a1, Atp6n1
MMRRC Submission 040718-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3727 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101009452-101063719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101030420 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 243 (S243T)
Ref Sequence ENSEMBL: ENSMUSP00000131848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044721] [ENSMUST00000092663] [ENSMUST00000103110] [ENSMUST00000168757]
Predicted Effect probably benign
Transcript: ENSMUST00000044721
AA Change: S243T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000044838
Gene: ENSMUSG00000019302
AA Change: S243T

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 829 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092663
AA Change: S243T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000090333
Gene: ENSMUSG00000019302
AA Change: S243T

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103110
AA Change: S250T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099399
Gene: ENSMUSG00000019302
AA Change: S250T

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 829 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134919
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154896
Predicted Effect probably benign
Transcript: ENSMUST00000168757
AA Change: S243T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000131848
Gene: ENSMUSG00000019302
AA Change: S243T

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 829 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185166
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene encodes one of three A subunit proteins and the encoded protein is associated with clathrin-coated vesicles. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,113,857 V630M probably damaging Het
Alk T C 17: 71,901,400 probably benign Het
BC035044 C A 6: 128,890,859 G37* probably null Het
C3 G T 17: 57,207,379 N1435K possibly damaging Het
Caly T C 7: 140,070,504 E175G probably damaging Het
Ccng2 T C 5: 93,274,951 F330S probably damaging Het
Cyp2c38 A G 19: 39,392,295 probably benign Het
Cypt1 T A X: 16,523,435 L128* probably null Het
Dmgdh A G 13: 93,692,067 N239D probably damaging Het
Dnah8 C T 17: 30,739,648 Q2155* probably null Het
Dpp3 A G 19: 4,923,185 I127T probably benign Het
Dusp27 G A 1: 166,099,506 R846C probably damaging Het
Eps15 G T 4: 109,370,685 probably benign Het
Exosc10 A G 4: 148,565,277 D388G probably damaging Het
Flt3 C A 5: 147,354,923 R572S probably damaging Het
Gm44501 T C 17: 40,576,615 F8S unknown Het
Hormad2 C A 11: 4,408,598 G270C probably benign Het
Ifrd2 C T 9: 107,591,682 R40* probably null Het
Ina G A 19: 47,015,719 R322H possibly damaging Het
Kif13b A G 14: 64,765,748 probably benign Het
Lrp2 T C 2: 69,510,429 N1034S probably damaging Het
Macf1 T A 4: 123,459,311 E1770V probably damaging Het
Mpi T C 9: 57,544,849 I381M possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nt5c C T 11: 115,490,648 W185* probably null Het
Olfr137 A T 17: 38,305,419 I14N possibly damaging Het
Olfr1391 G A 11: 49,327,795 R128H probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pdzrn3 T A 6: 101,156,945 D441V probably damaging Het
Rab42 A G 4: 132,302,653 M86T probably benign Het
Slc52a3 C T 2: 152,005,781 P270S probably benign Het
Stpg2 T C 3: 139,298,496 F278S probably damaging Het
Tmem2 G A 19: 21,844,711 A1157T probably benign Het
Tmem240 T C 4: 155,739,778 probably benign Het
Vmn2r22 A G 6: 123,650,625 L4P possibly damaging Het
Vmn2r95 C T 17: 18,441,482 Q497* probably null Het
Wnk1 T C 6: 119,992,453 H347R probably damaging Het
Zmym2 A T 14: 56,919,349 probably benign Het
Other mutations in Atp6v0a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Atp6v0a1 APN 11 101030505 critical splice donor site probably null
IGL01024:Atp6v0a1 APN 11 101048439 missense probably benign 0.00
IGL01390:Atp6v0a1 APN 11 101043802 missense probably benign 0.01
IGL02214:Atp6v0a1 APN 11 101039840 missense probably benign 0.01
IGL02639:Atp6v0a1 APN 11 101055518 missense possibly damaging 0.90
R0125:Atp6v0a1 UTSW 11 101038851 splice site probably null
R0193:Atp6v0a1 UTSW 11 101048482 missense possibly damaging 0.90
R0265:Atp6v0a1 UTSW 11 101048515 missense possibly damaging 0.80
R0973:Atp6v0a1 UTSW 11 101055491 nonsense probably null
R0973:Atp6v0a1 UTSW 11 101055491 nonsense probably null
R0974:Atp6v0a1 UTSW 11 101055491 nonsense probably null
R1460:Atp6v0a1 UTSW 11 101033998 missense probably damaging 1.00
R1580:Atp6v0a1 UTSW 11 101029204 missense probably damaging 1.00
R1625:Atp6v0a1 UTSW 11 101055554 missense probably damaging 1.00
R1644:Atp6v0a1 UTSW 11 101038786 missense possibly damaging 0.65
R1779:Atp6v0a1 UTSW 11 101026685 missense probably benign 0.01
R2895:Atp6v0a1 UTSW 11 101044598 missense probably benign
R2926:Atp6v0a1 UTSW 11 101043948 missense probably damaging 0.99
R3943:Atp6v0a1 UTSW 11 101055517 missense probably benign 0.00
R4820:Atp6v0a1 UTSW 11 101042950 missense probably benign 0.00
R5119:Atp6v0a1 UTSW 11 101020515 missense probably benign 0.02
R5250:Atp6v0a1 UTSW 11 101043044 missense possibly damaging 0.94
R5377:Atp6v0a1 UTSW 11 101055587 missense probably damaging 1.00
R5393:Atp6v0a1 UTSW 11 101038807 missense possibly damaging 0.95
R5497:Atp6v0a1 UTSW 11 101029185 missense probably damaging 1.00
R5787:Atp6v0a1 UTSW 11 101018574 missense probably benign 0.04
R6054:Atp6v0a1 UTSW 11 101039889 missense possibly damaging 0.91
R6076:Atp6v0a1 UTSW 11 101055060 missense probably damaging 1.00
R6889:Atp6v0a1 UTSW 11 101029183 missense possibly damaging 0.87
R7035:Atp6v0a1 UTSW 11 101027357 missense probably damaging 0.97
R7084:Atp6v0a1 UTSW 11 101034042 missense probably damaging 1.00
R7212:Atp6v0a1 UTSW 11 101043957 missense probably benign 0.08
X0023:Atp6v0a1 UTSW 11 101044597 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTGTAGAGAATGTCAAGACTGCTC -3'
(R):5'- TTGGTATCCAACTGCTACAGG -3'

Sequencing Primer
(F):5'- CAAGACTGCTCGGCATTATTG -3'
(R):5'- GGTGCCTCAACAAACTGTCAAGG -3'
Posted On2015-03-18