Incidental Mutation 'R3729:Map2'
ID270858
Institutional Source Beutler Lab
Gene Symbol Map2
Ensembl Gene ENSMUSG00000015222
Gene Namemicrotubule-associated protein 2
Synonymsrepro4, MAP-2, Mtap2, G1-397-34
MMRRC Submission 040719-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock #R3729 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location66175273-66442583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66412446 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 247 (E247G)
Ref Sequence ENSEMBL: ENSMUSP00000134471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024639] [ENSMUST00000077355] [ENSMUST00000114012] [ENSMUST00000114013] [ENSMUST00000114015] [ENSMUST00000114017] [ENSMUST00000114018] [ENSMUST00000145419] [ENSMUST00000172886] [ENSMUST00000173778] [ENSMUST00000173800] [ENSMUST00000173855]
Predicted Effect probably benign
Transcript: ENSMUST00000024639
SMART Domains Protein: ENSMUSP00000024639
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077355
SMART Domains Protein: ENSMUSP00000076577
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114012
SMART Domains Protein: ENSMUSP00000109645
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 133 140 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
low complexity region 228 250 N/A INTRINSIC
Pfam:Tubulin-binding 299 330 2.1e-18 PFAM
Pfam:Tubulin-binding 331 361 9.1e-20 PFAM
Pfam:Tubulin-binding 362 393 1.7e-17 PFAM
low complexity region 421 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114013
AA Change: E165G

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109646
Gene: ENSMUSG00000015222
AA Change: E165G

DomainStartEndE-ValueType
Pfam:RII_binding_1 86 103 1.2e-5 PFAM
low complexity region 120 141 N/A INTRINSIC
Pfam:MAP2_projctn 376 1510 N/A PFAM
low complexity region 1543 1557 N/A INTRINSIC
low complexity region 1567 1583 N/A INTRINSIC
low complexity region 1590 1612 N/A INTRINSIC
Pfam:Tubulin-binding 1662 1692 1.7e-13 PFAM
Pfam:Tubulin-binding 1693 1723 5.8e-18 PFAM
Pfam:Tubulin-binding 1724 1755 5.9e-18 PFAM
low complexity region 1783 1796 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114015
SMART Domains Protein: ENSMUSP00000109648
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114017
SMART Domains Protein: ENSMUSP00000109650
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114018
SMART Domains Protein: ENSMUSP00000109651
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133522
Predicted Effect unknown
Transcript: ENSMUST00000141148
AA Change: E100G
SMART Domains Protein: ENSMUSP00000117996
Gene: ENSMUSG00000015222
AA Change: E100G

DomainStartEndE-ValueType
Pfam:RII_binding_1 23 40 3.2e-6 PFAM
low complexity region 70 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145419
AA Change: E7G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000134538
Gene: ENSMUSG00000015222
AA Change: E7G

DomainStartEndE-ValueType
Pfam:MAP2_projctn 218 608 1.7e-250 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151423
Predicted Effect probably benign
Transcript: ENSMUST00000172886
SMART Domains Protein: ENSMUSP00000133446
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 107 3.9e-54 PFAM
low complexity region 112 126 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
low complexity region 159 181 N/A INTRINSIC
Pfam:Tubulin-binding 230 261 1.4e-18 PFAM
Pfam:Tubulin-binding 262 292 1.4e-19 PFAM
Pfam:Tubulin-binding 293 323 6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173778
SMART Domains Protein: ENSMUSP00000134651
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 124 4.8e-84 PFAM
low complexity region 157 171 N/A INTRINSIC
low complexity region 181 197 N/A INTRINSIC
low complexity region 204 226 N/A INTRINSIC
Pfam:Tubulin-binding 275 306 1.6e-18 PFAM
Pfam:Tubulin-binding 307 337 1.6e-19 PFAM
Pfam:Tubulin-binding 338 368 7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173800
SMART Domains Protein: ENSMUSP00000134518
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 23 2.2e-11 PFAM
low complexity region 55 69 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 102 124 N/A INTRINSIC
Pfam:Tubulin-binding 173 204 8.7e-19 PFAM
Pfam:Tubulin-binding 205 235 3.8e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173855
AA Change: E247G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134471
Gene: ENSMUSG00000015222
AA Change: E247G

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 142 163 N/A INTRINSIC
Pfam:MAP2_projctn 458 565 1.1e-52 PFAM
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The products of similar genes in rat and mouse are neuron-specific cytoskeletal proteins that are enriched in dentrites, implicating a role in determining and stabilizing dentritic shape during neuron development. A number of alternatively spliced variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered contextual memory. Mice homozygous for another knock-out allele display decreased body weight, altered microtubule density and organization in Purkinje cell dendrites, and reduced dendritic length inhippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,207,348 D954G probably damaging Het
Acvr1 T C 2: 58,462,913 K345R probably null Het
Aldoart2 A G 12: 55,566,319 Y343C probably damaging Het
Arpp21 T A 9: 112,065,979 Y739F possibly damaging Het
Cachd1 C A 4: 100,974,880 Y746* probably null Het
Card14 T C 11: 119,333,932 V595A probably damaging Het
Dhx33 T C 11: 70,989,152 D344G probably benign Het
Dnah12 T A 14: 26,706,065 D171E probably benign Het
Fat3 A G 9: 16,247,041 probably benign Het
Fmnl3 A G 15: 99,321,864 F668L probably damaging Het
Frmpd4 G A X: 167,486,807 T493M probably damaging Het
Gcn1l1 A T 5: 115,583,394 probably benign Het
Hspbp1 G T 7: 4,677,809 Q223K probably damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Igkv4-90 A G 6: 68,807,681 F10L probably benign Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Kif4-ps A G 12: 101,146,110 E166G probably damaging Het
Lemd3 T C 10: 120,928,015 D780G probably damaging Het
Manba G A 3: 135,554,850 V599I probably benign Het
Mfsd1 T C 3: 67,582,965 F50L probably benign Het
Mier2 T C 10: 79,545,042 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nol10 A T 12: 17,424,673 K622I probably benign Het
Olfr486 A T 7: 108,172,309 I145N probably benign Het
Olfr926 T C 9: 38,877,251 F25S probably damaging Het
Phtf1 A G 3: 103,985,779 M120V probably benign Het
Prrx1 A G 1: 163,261,877 L127P probably damaging Het
Rbsn T C 6: 92,191,335 M373V possibly damaging Het
Sec24b T C 3: 130,033,833 K203R possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc4a7 A T 14: 14,729,276 E47D probably damaging Het
Taf12 C A 4: 132,282,954 P78Q probably damaging Het
Tnn A G 1: 160,146,240 C186R probably damaging Het
Trim46 T A 3: 89,234,949 T721S probably benign Het
Trip4 T C 9: 65,880,942 N74D possibly damaging Het
Tssk5 C T 15: 76,372,896 R262H probably benign Het
Vegfa T C 17: 46,024,520 I105V possibly damaging Het
Vmn2r14 T C 5: 109,216,229 Y607C probably damaging Het
Wdr83 G T 8: 85,080,339 H66Q probably damaging Het
Zfp280b A G 10: 76,039,102 T272A probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Map2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Map2 APN 1 66425331 missense probably damaging 1.00
IGL02135:Map2 APN 1 66380761 nonsense probably null
IGL02526:Map2 APN 1 66380717 missense possibly damaging 0.94
Annas UTSW 1 66433597 critical splice donor site probably null
calliope UTSW 1 66425298 missense probably damaging 1.00
ruby_throat UTSW 1 66414884 missense possibly damaging 0.67
E0370:Map2 UTSW 1 66416724 unclassified probably benign
R0067:Map2 UTSW 1 66413163 missense probably benign 0.04
R0238:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0238:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0239:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0239:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0268:Map2 UTSW 1 66380722 nonsense probably null
R0302:Map2 UTSW 1 66414828 missense probably benign 0.15
R0305:Map2 UTSW 1 66413094 missense probably benign 0.00
R0409:Map2 UTSW 1 66433580 missense probably damaging 1.00
R0561:Map2 UTSW 1 66425497 missense probably damaging 1.00
R0674:Map2 UTSW 1 66413202 missense probably damaging 1.00
R0738:Map2 UTSW 1 66425189 splice site probably benign
R0893:Map2 UTSW 1 66380768 missense probably damaging 1.00
R1305:Map2 UTSW 1 66425395 missense probably damaging 1.00
R1534:Map2 UTSW 1 66413180 missense probably benign 0.33
R1632:Map2 UTSW 1 66415086 missense possibly damaging 0.60
R1682:Map2 UTSW 1 66415622 unclassified probably null
R1774:Map2 UTSW 1 66414074 missense probably damaging 1.00
R2014:Map2 UTSW 1 66416136 missense possibly damaging 0.55
R2017:Map2 UTSW 1 66412799 missense probably damaging 1.00
R2050:Map2 UTSW 1 66414314 missense probably damaging 0.98
R2093:Map2 UTSW 1 66399440 missense probably damaging 1.00
R2214:Map2 UTSW 1 66420186 missense probably damaging 0.99
R2284:Map2 UTSW 1 66414068 missense probably damaging 1.00
R3011:Map2 UTSW 1 66414612 missense probably damaging 1.00
R3105:Map2 UTSW 1 66433597 critical splice donor site probably null
R3708:Map2 UTSW 1 66416555 unclassified probably benign
R3709:Map2 UTSW 1 66415856 nonsense probably null
R3760:Map2 UTSW 1 66438918 missense probably damaging 1.00
R3788:Map2 UTSW 1 66416863 missense probably damaging 0.99
R3789:Map2 UTSW 1 66416863 missense probably damaging 0.99
R4003:Map2 UTSW 1 66415740 missense probably damaging 1.00
R4120:Map2 UTSW 1 66415904 missense probably damaging 1.00
R4172:Map2 UTSW 1 66413600 missense possibly damaging 0.89
R4198:Map2 UTSW 1 66425298 missense probably damaging 1.00
R4200:Map2 UTSW 1 66425298 missense probably damaging 1.00
R4205:Map2 UTSW 1 66425290 missense probably damaging 1.00
R4613:Map2 UTSW 1 66425469 missense probably damaging 1.00
R4700:Map2 UTSW 1 66410637 missense probably damaging 0.96
R4974:Map2 UTSW 1 66413505 missense probably benign 0.15
R5007:Map2 UTSW 1 66413289 missense possibly damaging 0.86
R5039:Map2 UTSW 1 66438796 missense probably damaging 1.00
R5237:Map2 UTSW 1 66439010 unclassified probably benign
R5313:Map2 UTSW 1 66425379 missense probably damaging 1.00
R5455:Map2 UTSW 1 66399391 missense probably damaging 1.00
R5490:Map2 UTSW 1 66413133 missense probably damaging 1.00
R5517:Map2 UTSW 1 66415256 missense probably benign 0.00
R5532:Map2 UTSW 1 66414620 missense probably damaging 1.00
R5583:Map2 UTSW 1 66416037 missense probably damaging 1.00
R5764:Map2 UTSW 1 66414875 missense probably damaging 0.99
R5996:Map2 UTSW 1 66414884 missense possibly damaging 0.67
R6058:Map2 UTSW 1 66415414 missense probably benign 0.05
R6199:Map2 UTSW 1 66425478 missense probably damaging 1.00
R6208:Map2 UTSW 1 66431590 missense probably damaging 1.00
R6276:Map2 UTSW 1 66399419 missense probably damaging 1.00
R6378:Map2 UTSW 1 66415329 missense probably damaging 1.00
R6424:Map2 UTSW 1 66414787 missense possibly damaging 0.67
R6743:Map2 UTSW 1 66415607 missense probably benign 0.04
R6837:Map2 UTSW 1 66414572 missense probably damaging 1.00
R6901:Map2 UTSW 1 66421773 missense possibly damaging 0.94
R6984:Map2 UTSW 1 66415236 missense possibly damaging 0.90
R6989:Map2 UTSW 1 66414906 missense probably benign 0.00
V8831:Map2 UTSW 1 66415845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGATTCCAGTCCTGACATTCC -3'
(R):5'- AGTCTGCGCAAATGGAACTGG -3'

Sequencing Primer
(F):5'- CATTTTTCAGTGGGCAGCATGC -3'
(R):5'- CGCAAATGGAACTGGAGGCAAC -3'
Posted On2015-03-18