Incidental Mutation 'R3729:Mslnl'
ID270900
Institutional Source Beutler Lab
Gene Symbol Mslnl
Ensembl Gene ENSMUSG00000041062
Gene Namemesothelin-like
Synonyms
MMRRC Submission 040719-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.036) question?
Stock #R3729 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25736040-25748330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25742934 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 128 (V128M)
Ref Sequence ENSEMBL: ENSMUSP00000049020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098]
Predicted Effect probably damaging
Transcript: ENSMUST00000047098
AA Change: V128M

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062
AA Change: V128M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102319
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,207,348 D954G probably damaging Het
Acvr1 T C 2: 58,462,913 K345R probably null Het
Aldoart2 A G 12: 55,566,319 Y343C probably damaging Het
Arpp21 T A 9: 112,065,979 Y739F possibly damaging Het
Cachd1 C A 4: 100,974,880 Y746* probably null Het
Card14 T C 11: 119,333,932 V595A probably damaging Het
Dhx33 T C 11: 70,989,152 D344G probably benign Het
Dnah12 T A 14: 26,706,065 D171E probably benign Het
Fat3 A G 9: 16,247,041 probably benign Het
Fmnl3 A G 15: 99,321,864 F668L probably damaging Het
Frmpd4 G A X: 167,486,807 T493M probably damaging Het
Gcn1l1 A T 5: 115,583,394 probably benign Het
Hspbp1 G T 7: 4,677,809 Q223K probably damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Igkv4-90 A G 6: 68,807,681 F10L probably benign Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Kif4-ps A G 12: 101,146,110 E166G probably damaging Het
Lemd3 T C 10: 120,928,015 D780G probably damaging Het
Manba G A 3: 135,554,850 V599I probably benign Het
Map2 A G 1: 66,412,446 E247G possibly damaging Het
Mfsd1 T C 3: 67,582,965 F50L probably benign Het
Mier2 T C 10: 79,545,042 probably benign Het
Nol10 A T 12: 17,424,673 K622I probably benign Het
Olfr486 A T 7: 108,172,309 I145N probably benign Het
Olfr926 T C 9: 38,877,251 F25S probably damaging Het
Phtf1 A G 3: 103,985,779 M120V probably benign Het
Prrx1 A G 1: 163,261,877 L127P probably damaging Het
Rbsn T C 6: 92,191,335 M373V possibly damaging Het
Sec24b T C 3: 130,033,833 K203R possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc4a7 A T 14: 14,729,276 E47D probably damaging Het
Taf12 C A 4: 132,282,954 P78Q probably damaging Het
Tnn A G 1: 160,146,240 C186R probably damaging Het
Trim46 T A 3: 89,234,949 T721S probably benign Het
Trip4 T C 9: 65,880,942 N74D possibly damaging Het
Tssk5 C T 15: 76,372,896 R262H probably benign Het
Vegfa T C 17: 46,024,520 I105V possibly damaging Het
Vmn2r14 T C 5: 109,216,229 Y607C probably damaging Het
Wdr83 G T 8: 85,080,339 H66Q probably damaging Het
Zfp280b A G 10: 76,039,102 T272A probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Mslnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Mslnl APN 17 25743667 unclassified probably benign
IGL01629:Mslnl APN 17 25744775 missense possibly damaging 0.95
IGL02084:Mslnl APN 17 25746151 missense probably benign 0.07
IGL02408:Mslnl APN 17 25747998 missense possibly damaging 0.80
IGL02726:Mslnl APN 17 25744103 critical splice donor site probably null
IGL03387:Mslnl APN 17 25744077 missense probably benign 0.06
R0561:Mslnl UTSW 17 25743203 nonsense probably null
R0881:Mslnl UTSW 17 25742965 missense possibly damaging 0.82
R1295:Mslnl UTSW 17 25743240 missense probably damaging 1.00
R1296:Mslnl UTSW 17 25743240 missense probably damaging 1.00
R1582:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1629:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1630:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1631:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1632:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1794:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1850:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1866:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1876:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1914:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2166:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2241:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2243:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2247:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2282:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2284:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2852:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2877:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2878:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2919:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2920:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3026:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3405:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3406:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3411:Mslnl UTSW 17 25744517 missense probably benign 0.05
R3434:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3546:Mslnl UTSW 17 25744969 missense probably damaging 0.98
R3612:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3730:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3802:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3804:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3894:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3895:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4454:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4455:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4456:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4457:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4561:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4562:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4564:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4600:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4601:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4610:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4704:Mslnl UTSW 17 25738978 missense possibly damaging 0.73
R5155:Mslnl UTSW 17 25738968 nonsense probably null
R5257:Mslnl UTSW 17 25746165 missense probably benign 0.00
R5456:Mslnl UTSW 17 25743159 missense probably damaging 0.98
R5645:Mslnl UTSW 17 25737842 missense possibly damaging 0.95
R6007:Mslnl UTSW 17 25746775 missense probably benign 0.00
R6083:Mslnl UTSW 17 25737902 missense possibly damaging 0.83
R6142:Mslnl UTSW 17 25744557 missense probably damaging 1.00
R6761:Mslnl UTSW 17 25746073 missense probably damaging 1.00
R7058:Mslnl UTSW 17 25743212 missense probably benign 0.03
R7156:Mslnl UTSW 17 25743210 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- CTGCCATCAGAAGGGAGGTTTG -3'
(R):5'- CCAAGAAGCCACAGGTCTGAAG -3'

Sequencing Primer
(F):5'- TTTGAACCCAGGACTGAGGTGAC -3'
(R):5'- CCACAGGTCTGAAGCACTGAG -3'
Posted On2015-03-18