Incidental Mutation 'R3730:Cyp3a25'
ID270925
Institutional Source Beutler Lab
Gene Symbol Cyp3a25
Ensembl Gene ENSMUSG00000029630
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 25
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R3730 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location145977194-146009618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 146003081 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 39 (P39S)
Ref Sequence ENSEMBL: ENSMUSP00000065585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068317] [ENSMUST00000138870] [ENSMUST00000145062]
Predicted Effect probably damaging
Transcript: ENSMUST00000068317
AA Change: P39S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065585
Gene: ENSMUSG00000029630
AA Change: P39S

DomainStartEndE-ValueType
Pfam:p450 38 493 9.4e-129 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000138870
AA Change: P39S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116077
Gene: ENSMUSG00000029630
AA Change: P39S

DomainStartEndE-ValueType
Pfam:p450 38 126 2e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000145062
AA Change: P39S

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123615
Gene: ENSMUSG00000029630
AA Change: P39S

DomainStartEndE-ValueType
Pfam:p450 38 148 3.9e-21 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A G 1: 11,545,226 N141S probably damaging Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Acot12 T A 13: 91,760,026 F109Y possibly damaging Het
Adamts19 G A 18: 58,900,910 R319Q probably damaging Het
Akap1 T C 11: 88,845,182 E218G possibly damaging Het
Atg4b T A 1: 93,768,275 D45E probably damaging Het
Atoh1 A G 6: 64,729,573 E84G probably benign Het
Cfap54 A T 10: 93,011,473 Y951* probably null Het
Col4a4 T A 1: 82,455,751 probably null Het
Crlf1 A G 8: 70,499,442 T95A probably benign Het
Dhx9 C A 1: 153,478,120 A186S probably benign Het
Dusp16 A G 6: 134,718,861 S336P probably benign Het
Fcgbp T C 7: 28,085,457 V314A possibly damaging Het
Focad T C 4: 88,408,925 I157T possibly damaging Het
Frem3 A T 8: 80,615,916 T1613S probably damaging Het
Fshr C T 17: 89,001,715 V222I probably benign Het
Galnt13 A G 2: 54,933,507 N365S possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 A T 13: 70,603,240 S1576T probably damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Itga8 T C 2: 12,193,510 T555A possibly damaging Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Ktn1 A G 14: 47,701,149 E766G probably damaging Het
Ldlr C G 9: 21,731,801 A41G probably benign Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrp2 A T 2: 69,534,907 probably null Het
Mapk11 G A 15: 89,145,115 A248V probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npr2 T C 4: 43,640,999 S402P possibly damaging Het
Olfm2 T C 9: 20,672,767 N76D probably damaging Het
Olfr1047 A G 2: 86,228,851 I40T probably benign Het
Olfr853 T A 9: 19,537,151 I260F probably benign Het
Pias4 A T 10: 81,164,054 F55Y probably damaging Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Ripor3 C G 2: 167,992,819 E251Q probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc35e4 A G 11: 3,912,577 V204A possibly damaging Het
Syt4 T C 18: 31,444,136 H55R probably damaging Het
Tmem2 A G 19: 21,826,117 Y838C probably damaging Het
Trim46 T A 3: 89,234,949 T721S probably benign Het
Usf3 G T 16: 44,218,575 L1139F probably benign Het
Wdr66 A T 5: 123,326,568 I1280L possibly damaging Het
Xrn2 A T 2: 147,024,809 M100L probably benign Het
Zbtb33 C A X: 38,192,945 N243K probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Cyp3a25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cyp3a25 APN 5 146001463 nonsense probably null
IGL00430:Cyp3a25 APN 5 145993360 missense probably damaging 1.00
IGL00803:Cyp3a25 APN 5 146001443 splice site probably benign
IGL00928:Cyp3a25 APN 5 145986954 missense possibly damaging 0.94
IGL01557:Cyp3a25 APN 5 145984901 missense probably damaging 1.00
IGL01997:Cyp3a25 APN 5 145994956 missense possibly damaging 0.92
IGL02140:Cyp3a25 APN 5 146009463 splice site probably benign
IGL02267:Cyp3a25 APN 5 145998552 missense possibly damaging 0.48
IGL02272:Cyp3a25 APN 5 145993265 intron probably benign
IGL02327:Cyp3a25 APN 5 145986921 missense possibly damaging 0.50
IGL02411:Cyp3a25 APN 5 146001447 critical splice donor site probably benign
IGL02504:Cyp3a25 APN 5 145993331 missense probably benign 0.03
IGL02653:Cyp3a25 APN 5 146003110 missense possibly damaging 0.95
R0378:Cyp3a25 UTSW 5 145986842 missense probably damaging 1.00
R0403:Cyp3a25 UTSW 5 145998513 missense probably damaging 1.00
R0685:Cyp3a25 UTSW 5 145998546 missense probably damaging 1.00
R0725:Cyp3a25 UTSW 5 145994936 missense probably damaging 1.00
R0798:Cyp3a25 UTSW 5 145991533 missense probably damaging 0.98
R1061:Cyp3a25 UTSW 5 145986833 missense probably benign
R1519:Cyp3a25 UTSW 5 146001447 critical splice donor site probably null
R1628:Cyp3a25 UTSW 5 146001463 nonsense probably null
R1822:Cyp3a25 UTSW 5 145984953 missense probably damaging 1.00
R1824:Cyp3a25 UTSW 5 145984953 missense probably damaging 1.00
R1864:Cyp3a25 UTSW 5 145994929 missense probably damaging 0.98
R2062:Cyp3a25 UTSW 5 145986969 splice site probably benign
R2401:Cyp3a25 UTSW 5 145986968 critical splice acceptor site probably null
R2516:Cyp3a25 UTSW 5 146003027 splice site probably null
R3080:Cyp3a25 UTSW 5 145998531 missense probably benign 0.33
R3236:Cyp3a25 UTSW 5 146003128 splice site probably benign
R3694:Cyp3a25 UTSW 5 145989976 splice site probably null
R4112:Cyp3a25 UTSW 5 146003031 missense probably benign 0.18
R4258:Cyp3a25 UTSW 5 145991438 missense probably damaging 1.00
R4651:Cyp3a25 UTSW 5 145994891 missense probably benign 0.01
R4788:Cyp3a25 UTSW 5 145985082 nonsense probably null
R4899:Cyp3a25 UTSW 5 145977671 missense possibly damaging 0.59
R4926:Cyp3a25 UTSW 5 145991456 missense probably damaging 1.00
R4952:Cyp3a25 UTSW 5 145991524 missense probably benign 0.01
R5270:Cyp3a25 UTSW 5 145981502 missense probably benign 0.36
R5595:Cyp3a25 UTSW 5 145994863 critical splice donor site probably null
R5659:Cyp3a25 UTSW 5 145991546 missense possibly damaging 0.69
R5787:Cyp3a25 UTSW 5 145998503 missense probably benign 0.14
R6307:Cyp3a25 UTSW 5 145994956 missense possibly damaging 0.92
R6380:Cyp3a25 UTSW 5 145998547 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGTGAAAGAAATTGCAACTATAGGA -3'
(R):5'- TTTTATGGGAAGGACATTGGAGA -3'

Sequencing Primer
(F):5'- AAGCAGGTGGATCTCTGAATTCC -3'
(R):5'- TTGGAGAGGAGAGTAATTGGGATTG -3'
Posted On2015-03-18