Incidental Mutation 'R3731:Adar'
ID270971
Institutional Source Beutler Lab
Gene Symbol Adar
Ensembl Gene ENSMUSG00000027951
Gene Nameadenosine deaminase, RNA-specific
SynonymsAdar1p150, ADAR1, mZaADAR, Adar1p110
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3731 (G1)
Quality Score216
Status Not validated
Chromosome3
Chromosomal Location89715022-89753446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89746655 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 325 (I325T)
Ref Sequence ENSEMBL: ENSMUSP00000112969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029563] [ENSMUST00000098924] [ENSMUST00000107405] [ENSMUST00000118341] [ENSMUST00000121094] [ENSMUST00000200558]
Predicted Effect probably damaging
Transcript: ENSMUST00000029563
AA Change: I843T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029563
Gene: ENSMUSG00000027951
AA Change: I843T

DomainStartEndE-ValueType
Zalpha 134 203 8.97e-30 SMART
Zalpha 244 312 7.69e-29 SMART
low complexity region 322 337 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
DSRM 457 523 3.6e-21 SMART
DSRM 568 634 4.36e-20 SMART
DSRM 676 742 1.58e-17 SMART
ADEAMc 762 1145 3.74e-205 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098924
AA Change: I621T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096525
Gene: ENSMUSG00000027951
AA Change: I621T

DomainStartEndE-ValueType
Zalpha 1 64 3.1e-24 SMART
low complexity region 74 89 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
DSRM 209 275 3.6e-21 SMART
DSRM 320 386 4.36e-20 SMART
DSRM 428 494 1.58e-17 SMART
low complexity region 515 526 N/A INTRINSIC
ADEAMc 540 923 3.74e-205 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107405
AA Change: I869T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103028
Gene: ENSMUSG00000027951
AA Change: I869T

DomainStartEndE-ValueType
Zalpha 134 203 8.97e-30 SMART
Zalpha 244 312 7.69e-29 SMART
low complexity region 322 337 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
DSRM 457 523 3.6e-21 SMART
DSRM 568 634 4.36e-20 SMART
DSRM 676 742 1.58e-17 SMART
low complexity region 763 774 N/A INTRINSIC
ADEAMc 788 1171 3.74e-205 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118341
AA Change: I351T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113453
Gene: ENSMUSG00000027951
AA Change: I351T

DomainStartEndE-ValueType
DSRM 50 116 4.36e-20 SMART
DSRM 158 224 1.58e-17 SMART
low complexity region 245 256 N/A INTRINSIC
ADEAMc 270 653 3.74e-205 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121094
AA Change: I325T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112969
Gene: ENSMUSG00000027951
AA Change: I325T

DomainStartEndE-ValueType
DSRM 50 116 4.36e-20 SMART
DSRM 158 224 1.58e-17 SMART
ADEAMc 244 627 3.74e-205 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131030
Predicted Effect probably benign
Transcript: ENSMUST00000200558
SMART Domains Protein: ENSMUSP00000143441
Gene: ENSMUSG00000027950

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Neur_chan_LBD 29 234 1.5e-71 PFAM
Pfam:Neur_chan_memb 241 454 4.8e-61 PFAM
low complexity region 657 666 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for RNA editing by site-specific deamination of adenosines. This enzyme destabilizes double-stranded RNA through conversion of adenosine to inosine. Mutations in this gene have been associated with dyschromatosis symmetrica hereditaria. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous null mice die during gestation. Inactivation of this locus has been associated with increased apoptosis and, in some lines, defects in both primitive and definitive hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T A 16: 14,609,621 probably null Het
Abcc5 A T 16: 20,398,934 Y5* probably null Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Akap13 T C 7: 75,611,377 S92P probably benign Het
Atp1a4 A T 1: 172,233,961 V771E probably damaging Het
BC030867 A G 11: 102,257,906 E381G possibly damaging Het
Cfh A G 1: 140,119,970 S492P possibly damaging Het
Crlf1 A G 8: 70,499,442 T95A probably benign Het
Dennd2d T G 3: 106,499,955 F441V probably damaging Het
Dhx33 T C 11: 70,989,152 D344G probably benign Het
Disp3 A G 4: 148,252,827 S844P probably benign Het
Dock2 T C 11: 34,708,895 K286E probably damaging Het
Fam228a T C 12: 4,718,671 E203G probably benign Het
Fbxo38 GTGCTGCTGCTGCTGCTGCTGC GTGCTGCTGCTGCTGCTGC 18: 62,515,328 probably benign Het
Frmpd4 G A X: 167,486,807 T493M probably damaging Het
Galnt13 A G 2: 54,933,507 N365S possibly damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Ints4 A G 7: 97,506,101 Q320R probably benign Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Loxl3 T C 6: 83,050,671 probably null Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrp2 A T 2: 69,534,907 probably null Het
Manba G A 3: 135,554,850 V599I probably benign Het
Mbd6 A G 10: 127,285,768 probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nepn A T 10: 52,404,014 N401Y probably damaging Het
Nol10 A T 12: 17,424,673 K622I probably benign Het
Npas3 T C 12: 53,354,392 I40T probably benign Het
Olfr348 A T 2: 36,786,566 I14F possibly damaging Het
Olfr389 T C 11: 73,776,739 E196G probably benign Het
Olfr498 T C 7: 108,465,426 I34T possibly damaging Het
Olfr710 T A 7: 106,944,477 N175Y probably damaging Het
Olfr733 T A 14: 50,298,505 D268V probably damaging Het
Olfr952 T A 9: 39,427,069 M1L probably benign Het
Phtf1 A G 3: 103,985,779 M120V probably benign Het
Plxna2 A G 1: 194,788,885 Y988C probably benign Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Ripor3 C G 2: 167,992,819 E251Q probably damaging Het
Sec24b T C 3: 130,033,833 K203R possibly damaging Het
Serpina1d T A 12: 103,767,905 N47Y possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sirpb1c T C 3: 15,833,123 K184R probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Upp2 T C 2: 58,755,367 S41P probably benign Het
Vmn1r10 A G 6: 57,113,734 T104A probably damaging Het
Wdhd1 A C 14: 47,247,892 S838R possibly damaging Het
Zer1 A G 2: 30,110,911 V166A probably benign Het
Zfp217 T C 2: 170,114,388 N897D probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Adar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Adar APN 3 89730840 critical splice donor site probably null
IGL01743:Adar APN 3 89745440 nonsense probably null
IGL01982:Adar APN 3 89738090 missense probably benign 0.03
logimen UTSW 3 89730814 missense probably benign 0.04
R0153:Adar UTSW 3 89730814 missense probably benign 0.04
R0464:Adar UTSW 3 89735582 missense possibly damaging 0.90
R0674:Adar UTSW 3 89749823 intron probably benign
R0762:Adar UTSW 3 89739983 splice site probably benign
R1567:Adar UTSW 3 89735781 missense probably benign 0.19
R1807:Adar UTSW 3 89734865 missense probably benign 0.00
R1858:Adar UTSW 3 89739282 missense probably benign 0.01
R1964:Adar UTSW 3 89745895 missense probably benign 0.23
R2440:Adar UTSW 3 89734854 missense possibly damaging 0.86
R3854:Adar UTSW 3 89736258 missense probably damaging 1.00
R4005:Adar UTSW 3 89749787 missense probably damaging 1.00
R4105:Adar UTSW 3 89740094 missense probably benign 0.00
R4693:Adar UTSW 3 89735940 missense probably damaging 1.00
R4980:Adar UTSW 3 89730814 missense probably benign 0.04
R5096:Adar UTSW 3 89747291 makesense probably null
R5199:Adar UTSW 3 89745944 missense probably damaging 1.00
R5397:Adar UTSW 3 89735319 missense probably benign
R5406:Adar UTSW 3 89736111 missense probably damaging 1.00
R5411:Adar UTSW 3 89739212 missense probably benign 0.39
R5446:Adar UTSW 3 89740179 missense probably damaging 1.00
R5660:Adar UTSW 3 89735594 missense probably damaging 1.00
R5724:Adar UTSW 3 89735169 missense probably benign
R6087:Adar UTSW 3 89745590 missense probably benign 0.05
R6935:Adar UTSW 3 89747218 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGCCAGGGGTGTTCTATTC -3'
(R):5'- CTAAGTACAGGGCCTCACAC -3'

Sequencing Primer
(F):5'- GGGGTGTTCTATTCCCTAATCTAAAG -3'
(R):5'- CTCACACGGAGGGAGAGC -3'
Posted On2015-03-18