Incidental Mutation 'R3732:Iqcg'
ID271056
Institutional Source Beutler Lab
Gene Symbol Iqcg
Ensembl Gene ENSMUSG00000035578
Gene NameIQ motif containing G
Synonyms
MMRRC Submission 040720-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3732 (G1)
Quality Score210
Status Validated
Chromosome16
Chromosomal Location33012683-33056218 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 33053626 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040309] [ENSMUST00000078804] [ENSMUST00000115075] [ENSMUST00000115076] [ENSMUST00000115078] [ENSMUST00000115079] [ENSMUST00000115100]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000040309
SMART Domains Protein: ENSMUSP00000041686
Gene: ENSMUSG00000035578

DomainStartEndE-ValueType
low complexity region 38 53 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078804
SMART Domains Protein: ENSMUSP00000077857
Gene: ENSMUSG00000060636

DomainStartEndE-ValueType
Pfam:Ribosomal_L35Ae 5 104 1e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105610
Predicted Effect probably benign
Transcript: ENSMUST00000115075
SMART Domains Protein: ENSMUSP00000110727
Gene: ENSMUSG00000060636

DomainStartEndE-ValueType
Pfam:Ribosomal_L35Ae 5 104 1e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115076
SMART Domains Protein: ENSMUSP00000110728
Gene: ENSMUSG00000060636

DomainStartEndE-ValueType
Pfam:Ribosomal_L35Ae 5 104 7e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115078
SMART Domains Protein: ENSMUSP00000110730
Gene: ENSMUSG00000060636

DomainStartEndE-ValueType
Pfam:Ribosomal_L35Ae 5 104 1e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115079
SMART Domains Protein: ENSMUSP00000110731
Gene: ENSMUSG00000060636

DomainStartEndE-ValueType
Pfam:Ribosomal_L35Ae 5 104 1e-46 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000115100
AA Change: D2E
SMART Domains Protein: ENSMUSP00000110752
Gene: ENSMUSG00000035578
AA Change: D2E

DomainStartEndE-ValueType
low complexity region 3 50 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
coiled coil region 248 329 N/A INTRINSIC
IQ 371 393 1.54e-2 SMART
low complexity region 399 419 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133785
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232188
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (44/44)
MGI Phenotype PHENOTYPE: Homozygous male mice are infertile and have very low epididymal sperm concentration with low motility, predominantly appearing as sperm heads without tails or with short tails. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik C T 11: 101,988,452 Q17* probably null Het
Ablim1 A T 19: 57,049,460 probably null Het
Adgrl3 C A 5: 81,794,946 H1474Q probably benign Het
Adgrv1 T C 13: 81,556,956 I1578M probably damaging Het
Arhgef10l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 4: 140,581,619 probably benign Het
Bcl7b A G 5: 135,180,913 T141A probably benign Het
Chrna3 T C 9: 55,015,894 K210R probably benign Het
Cpsf2 T C 12: 101,987,308 I199T probably damaging Het
Cyp2a4 A G 7: 26,312,827 D345G probably damaging Het
Cyp2s1 C T 7: 25,803,954 R424Q probably null Het
D1Pas1 C A 1: 186,968,097 S74R probably benign Het
Edem1 T C 6: 108,841,621 F197L probably damaging Het
Ergic2 T C 6: 148,202,522 D79G probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 T C 8: 44,953,269 V1019A possibly damaging Het
Fbxl21 T A 13: 56,527,017 H60Q probably benign Het
Fbxw7 A C 3: 84,925,707 K19Q possibly damaging Het
Gldn A G 9: 54,338,662 K499R possibly damaging Het
Gria4 C T 9: 4,513,295 M271I probably benign Het
Herc1 C T 9: 66,445,640 T2136I probably damaging Het
Itih2 A T 2: 10,105,670 F537I probably benign Het
Itpr2 T C 6: 146,382,700 D533G probably damaging Het
Kcnk15 A G 2: 163,853,813 K22E probably benign Het
Lag3 A T 6: 124,910,140 S155T probably benign Het
Lars T C 18: 42,212,602 E1003G probably benign Het
Layn T A 9: 51,059,544 N233I probably damaging Het
Lgi1 T C 19: 38,306,246 Y465H probably damaging Het
Lrig1 C T 6: 94,611,576 A531T possibly damaging Het
Mtx2 C A 2: 74,847,262 A22E probably damaging Het
Nipal3 T C 4: 135,463,846 T325A probably damaging Het
Ola1 G C 2: 73,156,860 R143G probably damaging Het
Otog A G 7: 46,288,368 T1834A probably benign Het
Panx1 GTTCTTCT GTTCT 9: 15,006,171 probably benign Het
Pcdh18 T C 3: 49,754,791 S692G probably benign Het
Pkd2 G A 5: 104,489,419 probably null Het
Ppp1r9a T C 6: 4,906,259 probably benign Het
Robo2 A C 16: 73,920,747 L1159W possibly damaging Het
Sfxn5 T C 6: 85,299,276 probably benign Het
Shf T A 2: 122,345,207 probably benign Het
Siah2 A G 3: 58,676,250 V205A probably damaging Het
Slc44a4 G A 17: 34,921,561 silent Het
Spindoc A C 19: 7,374,301 L202R probably damaging Het
Spock3 T A 8: 63,345,699 D251E probably damaging Het
Stk4 T A 2: 164,088,908 M143K probably benign Het
Trpc3 A T 3: 36,638,559 D761E probably benign Het
Twf1 A C 15: 94,584,414 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vps50 T C 6: 3,519,243 silent Het
Wapl G A 14: 34,736,764 V928I probably damaging Het
Zfand3 A G 17: 30,192,656 K130R probably benign Het
Other mutations in Iqcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Iqcg APN 16 33035600 missense possibly damaging 0.90
IGL01155:Iqcg APN 16 33040875 missense probably damaging 0.99
IGL01602:Iqcg APN 16 33016978 unclassified probably benign
IGL01605:Iqcg APN 16 33016978 unclassified probably benign
IGL02243:Iqcg APN 16 33045592 missense probably damaging 1.00
IGL02328:Iqcg APN 16 33019506 missense probably benign 0.00
IGL02490:Iqcg APN 16 33035567 nonsense probably null
IGL03297:Iqcg APN 16 33035632 splice site probably benign
R0038:Iqcg UTSW 16 33045642 missense probably benign 0.03
R0453:Iqcg UTSW 16 33049843 splice site probably benign
R0719:Iqcg UTSW 16 33040845 missense probably benign 0.26
R1191:Iqcg UTSW 16 33049943 missense probably benign 0.43
R1544:Iqcg UTSW 16 33045525 missense probably benign 0.01
R2292:Iqcg UTSW 16 33049883 missense probably benign 0.25
R3725:Iqcg UTSW 16 33020539 unclassified probably null
R3726:Iqcg UTSW 16 33029041 missense probably damaging 1.00
R3732:Iqcg UTSW 16 33053626 unclassified probably benign
R3733:Iqcg UTSW 16 33053626 unclassified probably benign
R3734:Iqcg UTSW 16 33053626 unclassified probably benign
R3770:Iqcg UTSW 16 33050008 synonymous silent
R4296:Iqcg UTSW 16 33016975 unclassified probably benign
R4409:Iqcg UTSW 16 33045518 critical splice donor site probably null
R4410:Iqcg UTSW 16 33030816 missense possibly damaging 0.95
R4429:Iqcg UTSW 16 33019490 missense probably benign 0.02
R4603:Iqcg UTSW 16 33040764 missense probably null 0.68
R4603:Iqcg UTSW 16 33040763 critical splice donor site probably null
R4979:Iqcg UTSW 16 33019514 missense probably damaging 1.00
R5672:Iqcg UTSW 16 33019508 missense probably damaging 0.99
R6183:Iqcg UTSW 16 33030923 missense probably damaging 1.00
R6965:Iqcg UTSW 16 33030804 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CAGAGTCACTTGCTAAACGCCC -3'
(R):5'- TTCCCTAAGCAGGAGGAGAC -3'

Sequencing Primer
(F):5'- GTCACTTGCTAAACGCCCTCAAG -3'
(R):5'- CTATAGATAGCTCTTGGGATTCTGTG -3'
Posted On2015-03-18