Incidental Mutation 'R3733:Mtx2'
ID271069
Institutional Source Beutler Lab
Gene Symbol Mtx2
Ensembl Gene ENSMUSG00000027099
Gene Namemetaxin 2
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.897) question?
Stock #R3733 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location74825803-74878431 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 74847262 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 22 (A22E)
Ref Sequence ENSEMBL: ENSMUSP00000028511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028511]
Predicted Effect probably damaging
Transcript: ENSMUST00000028511
AA Change: A22E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028511
Gene: ENSMUSG00000027099
AA Change: A22E

DomainStartEndE-ValueType
Pfam:GST_C_3 99 251 3.3e-21 PFAM
Pfam:GST_C_2 165 248 6.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155844
Meta Mutation Damage Score 0.0252 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the metaxin 2 protein from mouse, which has been shown to interact with the mitochondrial membrane protein metaxin 1. Because of this similarity, it is thought that the encoded protein is peripherally associated with the cytosolic face of the outer mitochondrial membrane, and that it is involved in the import of proteins into the mitochondrion. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik C T 11: 101,988,452 Q17* probably null Het
Ablim1 A T 19: 57,049,460 probably null Het
Adgrl3 C A 5: 81,794,946 H1474Q probably benign Het
Adgrv1 T C 13: 81,556,956 I1578M probably damaging Het
Bcl7b A G 5: 135,180,913 T141A probably benign Het
Chrna3 T C 9: 55,015,894 K210R probably benign Het
Cpsf2 T C 12: 101,987,308 I199T probably damaging Het
Cyp2a4 A G 7: 26,312,827 D345G probably damaging Het
Cyp2s1 C T 7: 25,803,954 R424Q probably null Het
D1Pas1 C A 1: 186,968,097 S74R probably benign Het
Edem1 T C 6: 108,841,621 F197L probably damaging Het
Ergic2 T C 6: 148,202,522 D79G probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 T C 8: 44,953,269 V1019A possibly damaging Het
Fbxl21 T A 13: 56,527,017 H60Q probably benign Het
Fbxw7 A C 3: 84,925,707 K19Q possibly damaging Het
Gldn A G 9: 54,338,662 K499R possibly damaging Het
Gria4 C T 9: 4,513,295 M271I probably benign Het
Herc1 C T 9: 66,445,640 T2136I probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Iqcg G T 16: 33,053,626 probably benign Het
Itih2 A T 2: 10,105,670 F537I probably benign Het
Itpr2 T C 6: 146,382,700 D533G probably damaging Het
Lag3 A T 6: 124,910,140 S155T probably benign Het
Lars T C 18: 42,212,602 E1003G probably benign Het
Layn T A 9: 51,059,544 N233I probably damaging Het
Lgi1 T C 19: 38,306,246 Y465H probably damaging Het
Lrig1 C T 6: 94,611,576 A531T possibly damaging Het
Mrps18b G A 17: 35,910,867 P97S probably damaging Het
Nipal3 T C 4: 135,463,846 T325A probably damaging Het
Ola1 G C 2: 73,156,860 R143G probably damaging Het
Otog A G 7: 46,288,368 T1834A probably benign Het
Panx1 GTTCTTCT GTTCT 9: 15,006,171 probably benign Het
Pcdh18 T C 3: 49,754,791 S692G probably benign Het
Pkd2 G A 5: 104,489,419 probably null Het
Robo2 A C 16: 73,920,747 L1159W possibly damaging Het
Sfxn5 T C 6: 85,299,276 probably benign Het
Siah2 A G 3: 58,676,250 V205A probably damaging Het
Spindoc A C 19: 7,374,301 L202R probably damaging Het
Spock3 T A 8: 63,345,699 D251E probably damaging Het
Stk4 T A 2: 164,088,908 M143K probably benign Het
Trpc3 A T 3: 36,638,559 D761E probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wapl G A 14: 34,736,764 V928I probably damaging Het
Zfand3 A G 17: 30,192,656 K130R probably benign Het
Other mutations in Mtx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01867:Mtx2 APN 2 74876389 missense probably damaging 1.00
IGL03277:Mtx2 APN 2 74868404 missense probably damaging 1.00
R0593:Mtx2 UTSW 2 74869436 splice site probably benign
R0638:Mtx2 UTSW 2 74869290 splice site probably benign
R2240:Mtx2 UTSW 2 74869352 missense probably benign 0.00
R2906:Mtx2 UTSW 2 74866909 missense probably damaging 1.00
R3151:Mtx2 UTSW 2 74847290 splice site probably null
R3732:Mtx2 UTSW 2 74847262 missense probably damaging 1.00
R3732:Mtx2 UTSW 2 74847262 missense probably damaging 1.00
R6918:Mtx2 UTSW 2 74876353 missense probably damaging 1.00
R7154:Mtx2 UTSW 2 74876418 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATCCAGTCTAAGATAGTGTGATTC -3'
(R):5'- TGGCAGGTACAAGTTTAGGC -3'

Sequencing Primer
(F):5'- CAGTGCTGTCGTGTCACCTTAAAG -3'
(R):5'- TGGCAGGTACAAGTTTAGGCAAAAC -3'
Posted On2015-03-18