Incidental Mutation 'R3733:Spock3'
ID271090
Institutional Source Beutler Lab
Gene Symbol Spock3
Ensembl Gene ENSMUSG00000054162
Gene Namesparc/osteonectin, cwcv and kazal-like domains proteoglycan 3
Synonymstestican 3, 2900045C01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3733 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location62951009-63357103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63345699 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 251 (D251E)
Ref Sequence ENSEMBL: ENSMUSP00000112930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093480] [ENSMUST00000117377] [ENSMUST00000118003] [ENSMUST00000119068]
Predicted Effect probably damaging
Transcript: ENSMUST00000093480
AA Change: D251E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091192
Gene: ENSMUSG00000054162
AA Change: D251E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 138 183 2.74e-11 SMART
Pfam:SPARC_Ca_bdg 198 308 8.5e-35 PFAM
TY 338 384 2.27e-17 SMART
low complexity region 403 434 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117377
AA Change: D248E

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113797
Gene: ENSMUSG00000054162
AA Change: D248E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 135 180 2.74e-11 SMART
Pfam:SPARC_Ca_bdg 195 305 5e-35 PFAM
TY 335 381 2.27e-17 SMART
low complexity region 400 431 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118003
AA Change: D251E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113683
Gene: ENSMUSG00000054162
AA Change: D251E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 138 183 2.74e-11 SMART
Pfam:SPARC_Ca_bdg 198 308 1.1e-36 PFAM
TY 338 384 2.27e-17 SMART
low complexity region 403 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119068
AA Change: D251E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112930
Gene: ENSMUSG00000054162
AA Change: D251E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 138 183 2.74e-11 SMART
Pfam:SPARC_Ca_bdg 198 308 8.5e-35 PFAM
TY 338 384 2.27e-17 SMART
low complexity region 403 434 N/A INTRINSIC
Meta Mutation Damage Score 0.0228 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a novel family of calcium-binding proteoglycan proteins that contain thyroglobulin type-1 and Kazal-like domains. The encoded protein and may play a role in adult T-cell leukemia by inhibiting the activity of membrane-type matrix metalloproteinases. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious morphological or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik C T 11: 101,988,452 Q17* probably null Het
Ablim1 A T 19: 57,049,460 probably null Het
Adgrl3 C A 5: 81,794,946 H1474Q probably benign Het
Adgrv1 T C 13: 81,556,956 I1578M probably damaging Het
Bcl7b A G 5: 135,180,913 T141A probably benign Het
Chrna3 T C 9: 55,015,894 K210R probably benign Het
Cpsf2 T C 12: 101,987,308 I199T probably damaging Het
Cyp2a4 A G 7: 26,312,827 D345G probably damaging Het
Cyp2s1 C T 7: 25,803,954 R424Q probably null Het
D1Pas1 C A 1: 186,968,097 S74R probably benign Het
Edem1 T C 6: 108,841,621 F197L probably damaging Het
Ergic2 T C 6: 148,202,522 D79G probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 T C 8: 44,953,269 V1019A possibly damaging Het
Fbxl21 T A 13: 56,527,017 H60Q probably benign Het
Fbxw7 A C 3: 84,925,707 K19Q possibly damaging Het
Gldn A G 9: 54,338,662 K499R possibly damaging Het
Gria4 C T 9: 4,513,295 M271I probably benign Het
Herc1 C T 9: 66,445,640 T2136I probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Iqcg G T 16: 33,053,626 probably benign Het
Itih2 A T 2: 10,105,670 F537I probably benign Het
Itpr2 T C 6: 146,382,700 D533G probably damaging Het
Lag3 A T 6: 124,910,140 S155T probably benign Het
Lars T C 18: 42,212,602 E1003G probably benign Het
Layn T A 9: 51,059,544 N233I probably damaging Het
Lgi1 T C 19: 38,306,246 Y465H probably damaging Het
Lrig1 C T 6: 94,611,576 A531T possibly damaging Het
Mrps18b G A 17: 35,910,867 P97S probably damaging Het
Mtx2 C A 2: 74,847,262 A22E probably damaging Het
Nipal3 T C 4: 135,463,846 T325A probably damaging Het
Ola1 G C 2: 73,156,860 R143G probably damaging Het
Otog A G 7: 46,288,368 T1834A probably benign Het
Panx1 GTTCTTCT GTTCT 9: 15,006,171 probably benign Het
Pcdh18 T C 3: 49,754,791 S692G probably benign Het
Pkd2 G A 5: 104,489,419 probably null Het
Robo2 A C 16: 73,920,747 L1159W possibly damaging Het
Sfxn5 T C 6: 85,299,276 probably benign Het
Siah2 A G 3: 58,676,250 V205A probably damaging Het
Spindoc A C 19: 7,374,301 L202R probably damaging Het
Stk4 T A 2: 164,088,908 M143K probably benign Het
Trpc3 A T 3: 36,638,559 D761E probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wapl G A 14: 34,736,764 V928I probably damaging Het
Zfand3 A G 17: 30,192,656 K130R probably benign Het
Other mutations in Spock3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Spock3 APN 8 63348959 missense probably benign 0.01
IGL01716:Spock3 APN 8 63355350 missense unknown
IGL02058:Spock3 APN 8 63245198 nonsense probably null
IGL02450:Spock3 APN 8 63245215 critical splice donor site probably null
IGL02610:Spock3 APN 8 63345737 missense probably damaging 1.00
IGL03046:Spock3 UTSW 8 63348984 critical splice donor site probably null
R0044:Spock3 UTSW 8 63144007 missense possibly damaging 0.90
R0044:Spock3 UTSW 8 63144007 missense possibly damaging 0.90
R0084:Spock3 UTSW 8 63143929 missense probably damaging 1.00
R1422:Spock3 UTSW 8 63143989 missense possibly damaging 0.89
R1469:Spock3 UTSW 8 62951900 missense probably damaging 0.99
R1469:Spock3 UTSW 8 62951900 missense probably damaging 0.99
R1484:Spock3 UTSW 8 63220705 missense probably damaging 1.00
R1728:Spock3 UTSW 8 63348977 missense probably damaging 0.99
R1729:Spock3 UTSW 8 63348977 missense probably damaging 0.99
R1739:Spock3 UTSW 8 63348947 missense probably damaging 0.99
R2057:Spock3 UTSW 8 63245170 nonsense probably null
R2340:Spock3 UTSW 8 63345713 missense probably damaging 1.00
R3732:Spock3 UTSW 8 63345699 missense probably damaging 1.00
R3732:Spock3 UTSW 8 63345699 missense probably damaging 1.00
R3763:Spock3 UTSW 8 63144015 critical splice donor site probably null
R5000:Spock3 UTSW 8 63245124 missense possibly damaging 0.86
R5069:Spock3 UTSW 8 63355265 missense probably benign 0.01
R5076:Spock3 UTSW 8 63345855 missense probably damaging 1.00
R5232:Spock3 UTSW 8 63345809 missense probably damaging 1.00
R5329:Spock3 UTSW 8 63345782 missense probably damaging 1.00
R5621:Spock3 UTSW 8 63144006 missense probably benign 0.19
R5882:Spock3 UTSW 8 63143931 missense probably benign 0.03
R5888:Spock3 UTSW 8 63355300 missense unknown
R5902:Spock3 UTSW 8 63355302 missense unknown
R6991:Spock3 UTSW 8 63355381 makesense probably null
R7317:Spock3 UTSW 8 63113556 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GACTGATTAGGAACAGATGTTGTC -3'
(R):5'- ACCTTGCTGTCTCTGGAAAC -3'

Sequencing Primer
(F):5'- GCTAATAGACGTTGAAAAACTTCCC -3'
(R):5'- TGGTGCACTGCTCATTCT -3'
Posted On2015-03-18