Incidental Mutation 'R3733:Chrna3'
ID271095
Institutional Source Beutler Lab
Gene Symbol Chrna3
Ensembl Gene ENSMUSG00000032303
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 3
SynonymsA730007P14Rik, Acra3, neuronal nicotinic acetylcholine receptor, alpha 3 subunit, alpha 3, (a)3, Acra-3
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R3733 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location55010111-55026562 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55015894 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 210 (K210R)
Ref Sequence ENSEMBL: ENSMUSP00000150636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034851] [ENSMUST00000214204]
Predicted Effect probably benign
Transcript: ENSMUST00000034851
AA Change: K210R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034851
Gene: ENSMUSG00000032303
AA Change: K210R

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Neur_chan_LBD 34 240 6.1e-77 PFAM
Pfam:Neur_chan_memb 247 494 7.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214204
AA Change: K210R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the nicotinic acetylcholine receptor family of proteins. Members of this family of proteins form pentameric complexes comprised of both alpha and beta subunits. This locus encodes an alpha-type subunit, as it contains characteristic adjacent cysteine residues. The encoded protein is a ligand-gated ion channel that likely plays a role in neurotransmission. Polymorphisms in this gene have been associated with an increased risk of smoking initiation and an increased susceptibility to lung cancer. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a targeted null mutation show high postnatal and postweaning mortality. Mutants show reduced bladder contractility resulting in enlarged bladder, infections and urinary stones. Eyes are small, with dilated ocular pupils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik C T 11: 101,988,452 Q17* probably null Het
Ablim1 A T 19: 57,049,460 probably null Het
Adgrl3 C A 5: 81,794,946 H1474Q probably benign Het
Adgrv1 T C 13: 81,556,956 I1578M probably damaging Het
Bcl7b A G 5: 135,180,913 T141A probably benign Het
Cpsf2 T C 12: 101,987,308 I199T probably damaging Het
Cyp2a4 A G 7: 26,312,827 D345G probably damaging Het
Cyp2s1 C T 7: 25,803,954 R424Q probably null Het
D1Pas1 C A 1: 186,968,097 S74R probably benign Het
Edem1 T C 6: 108,841,621 F197L probably damaging Het
Ergic2 T C 6: 148,202,522 D79G probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 T C 8: 44,953,269 V1019A possibly damaging Het
Fbxl21 T A 13: 56,527,017 H60Q probably benign Het
Fbxw7 A C 3: 84,925,707 K19Q possibly damaging Het
Gldn A G 9: 54,338,662 K499R possibly damaging Het
Gria4 C T 9: 4,513,295 M271I probably benign Het
Herc1 C T 9: 66,445,640 T2136I probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Iqcg G T 16: 33,053,626 probably benign Het
Itih2 A T 2: 10,105,670 F537I probably benign Het
Itpr2 T C 6: 146,382,700 D533G probably damaging Het
Lag3 A T 6: 124,910,140 S155T probably benign Het
Lars T C 18: 42,212,602 E1003G probably benign Het
Layn T A 9: 51,059,544 N233I probably damaging Het
Lgi1 T C 19: 38,306,246 Y465H probably damaging Het
Lrig1 C T 6: 94,611,576 A531T possibly damaging Het
Mrps18b G A 17: 35,910,867 P97S probably damaging Het
Mtx2 C A 2: 74,847,262 A22E probably damaging Het
Nipal3 T C 4: 135,463,846 T325A probably damaging Het
Ola1 G C 2: 73,156,860 R143G probably damaging Het
Otog A G 7: 46,288,368 T1834A probably benign Het
Panx1 GTTCTTCT GTTCT 9: 15,006,171 probably benign Het
Pcdh18 T C 3: 49,754,791 S692G probably benign Het
Pkd2 G A 5: 104,489,419 probably null Het
Robo2 A C 16: 73,920,747 L1159W possibly damaging Het
Sfxn5 T C 6: 85,299,276 probably benign Het
Siah2 A G 3: 58,676,250 V205A probably damaging Het
Spindoc A C 19: 7,374,301 L202R probably damaging Het
Spock3 T A 8: 63,345,699 D251E probably damaging Het
Stk4 T A 2: 164,088,908 M143K probably benign Het
Trpc3 A T 3: 36,638,559 D761E probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wapl G A 14: 34,736,764 V928I probably damaging Het
Zfand3 A G 17: 30,192,656 K130R probably benign Het
Other mutations in Chrna3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02469:Chrna3 APN 9 55016006 missense probably benign 0.01
IGL02484:Chrna3 APN 9 55015537 missense probably damaging 1.00
R0494:Chrna3 UTSW 9 55022278 missense probably damaging 1.00
R0538:Chrna3 UTSW 9 55016006 missense probably benign 0.01
R0557:Chrna3 UTSW 9 55015865 missense probably damaging 1.00
R0674:Chrna3 UTSW 9 55015172 missense probably damaging 1.00
R1552:Chrna3 UTSW 9 55015908 missense probably benign 0.16
R1750:Chrna3 UTSW 9 55016057 missense probably damaging 1.00
R2191:Chrna3 UTSW 9 55016045 missense probably damaging 1.00
R2989:Chrna3 UTSW 9 55016050 missense probably damaging 1.00
R3114:Chrna3 UTSW 9 55016050 missense probably damaging 1.00
R3153:Chrna3 UTSW 9 55016050 missense probably damaging 1.00
R3154:Chrna3 UTSW 9 55016050 missense probably damaging 1.00
R3434:Chrna3 UTSW 9 55024326 missense possibly damaging 0.95
R3732:Chrna3 UTSW 9 55015894 missense probably benign 0.00
R3732:Chrna3 UTSW 9 55015894 missense probably benign 0.00
R4758:Chrna3 UTSW 9 55022276 missense probably damaging 1.00
R4903:Chrna3 UTSW 9 55015526 missense probably benign 0.01
R5430:Chrna3 UTSW 9 55012908 missense probably damaging 0.98
R5795:Chrna3 UTSW 9 55015268 missense probably benign 0.17
R6546:Chrna3 UTSW 9 55015901 missense probably damaging 1.00
R6806:Chrna3 UTSW 9 55015810 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCAGAGCGTCACCTTCTC -3'
(R):5'- CACAGGAGAAGTGACTTGGATC -3'

Sequencing Primer
(F):5'- TTCTCCCCACAGTCGGAG -3'
(R):5'- AGAAGTGACTTGGATCCCTCC -3'
Posted On2015-03-18