Incidental Mutation 'R3733:Cpsf2'
ID271099
Institutional Source Beutler Lab
Gene Symbol Cpsf2
Ensembl Gene ENSMUSG00000041781
Gene Namecleavage and polyadenylation specific factor 2
Synonyms100kDa, 2610024B04Rik, Cpsf
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.980) question?
Stock #R3733 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location101975988-102006424 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101987308 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 199 (I199T)
Ref Sequence ENSEMBL: ENSMUSP00000047797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047357]
Predicted Effect probably damaging
Transcript: ENSMUST00000047357
AA Change: I199T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047797
Gene: ENSMUSG00000041781
AA Change: I199T

DomainStartEndE-ValueType
Lactamase_B 17 223 5.22e-1 SMART
Beta-Casp 243 368 1.8e-21 SMART
coiled coil region 380 418 N/A INTRINSIC
Pfam:RMMBL 527 569 1.2e-14 PFAM
Pfam:CPSF100_C 608 779 5.7e-46 PFAM
Meta Mutation Damage Score 0.312 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik C T 11: 101,988,452 Q17* probably null Het
Ablim1 A T 19: 57,049,460 probably null Het
Adgrl3 C A 5: 81,794,946 H1474Q probably benign Het
Adgrv1 T C 13: 81,556,956 I1578M probably damaging Het
Bcl7b A G 5: 135,180,913 T141A probably benign Het
Chrna3 T C 9: 55,015,894 K210R probably benign Het
Cyp2a4 A G 7: 26,312,827 D345G probably damaging Het
Cyp2s1 C T 7: 25,803,954 R424Q probably null Het
D1Pas1 C A 1: 186,968,097 S74R probably benign Het
Edem1 T C 6: 108,841,621 F197L probably damaging Het
Ergic2 T C 6: 148,202,522 D79G probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 T C 8: 44,953,269 V1019A possibly damaging Het
Fbxl21 T A 13: 56,527,017 H60Q probably benign Het
Fbxw7 A C 3: 84,925,707 K19Q possibly damaging Het
Gldn A G 9: 54,338,662 K499R possibly damaging Het
Gria4 C T 9: 4,513,295 M271I probably benign Het
Herc1 C T 9: 66,445,640 T2136I probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Iqcg G T 16: 33,053,626 probably benign Het
Itih2 A T 2: 10,105,670 F537I probably benign Het
Itpr2 T C 6: 146,382,700 D533G probably damaging Het
Lag3 A T 6: 124,910,140 S155T probably benign Het
Lars T C 18: 42,212,602 E1003G probably benign Het
Layn T A 9: 51,059,544 N233I probably damaging Het
Lgi1 T C 19: 38,306,246 Y465H probably damaging Het
Lrig1 C T 6: 94,611,576 A531T possibly damaging Het
Mrps18b G A 17: 35,910,867 P97S probably damaging Het
Mtx2 C A 2: 74,847,262 A22E probably damaging Het
Nipal3 T C 4: 135,463,846 T325A probably damaging Het
Ola1 G C 2: 73,156,860 R143G probably damaging Het
Otog A G 7: 46,288,368 T1834A probably benign Het
Panx1 GTTCTTCT GTTCT 9: 15,006,171 probably benign Het
Pcdh18 T C 3: 49,754,791 S692G probably benign Het
Pkd2 G A 5: 104,489,419 probably null Het
Robo2 A C 16: 73,920,747 L1159W possibly damaging Het
Sfxn5 T C 6: 85,299,276 probably benign Het
Siah2 A G 3: 58,676,250 V205A probably damaging Het
Spindoc A C 19: 7,374,301 L202R probably damaging Het
Spock3 T A 8: 63,345,699 D251E probably damaging Het
Stk4 T A 2: 164,088,908 M143K probably benign Het
Trpc3 A T 3: 36,638,559 D761E probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wapl G A 14: 34,736,764 V928I probably damaging Het
Zfand3 A G 17: 30,192,656 K130R probably benign Het
Other mutations in Cpsf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Cpsf2 APN 12 101983466 missense probably damaging 1.00
IGL01114:Cpsf2 APN 12 101989839 missense possibly damaging 0.93
IGL01121:Cpsf2 APN 12 101988706 missense probably damaging 1.00
IGL01377:Cpsf2 APN 12 101987381 splice site probably null
IGL01465:Cpsf2 APN 12 101997333 missense probably damaging 1.00
IGL02861:Cpsf2 APN 12 101999566 missense probably benign 0.00
R0469:Cpsf2 UTSW 12 101988786 missense probably damaging 1.00
R0504:Cpsf2 UTSW 12 101990003 missense probably damaging 1.00
R0510:Cpsf2 UTSW 12 101988786 missense probably damaging 1.00
R0626:Cpsf2 UTSW 12 101985231 missense probably benign 0.09
R0697:Cpsf2 UTSW 12 101983184 missense probably benign 0.34
R0837:Cpsf2 UTSW 12 101997242 splice site probably benign
R1475:Cpsf2 UTSW 12 101985236 missense probably damaging 1.00
R1709:Cpsf2 UTSW 12 101999542 missense probably damaging 1.00
R1974:Cpsf2 UTSW 12 101990047 missense probably benign 0.33
R1996:Cpsf2 UTSW 12 101998608 missense probably benign 0.18
R2063:Cpsf2 UTSW 12 101983463 missense probably damaging 1.00
R2164:Cpsf2 UTSW 12 101985335 missense probably damaging 1.00
R2228:Cpsf2 UTSW 12 101989829 missense probably benign 0.00
R3082:Cpsf2 UTSW 12 101988810 missense probably damaging 0.99
R3732:Cpsf2 UTSW 12 101987308 missense probably damaging 0.99
R3732:Cpsf2 UTSW 12 101987308 missense probably damaging 0.99
R4627:Cpsf2 UTSW 12 101989895 missense probably benign 0.18
R4665:Cpsf2 UTSW 12 101983207 missense probably damaging 1.00
R4666:Cpsf2 UTSW 12 101983207 missense probably damaging 1.00
R4765:Cpsf2 UTSW 12 101997440 missense probably damaging 1.00
R4777:Cpsf2 UTSW 12 101996832 missense probably damaging 0.99
R4847:Cpsf2 UTSW 12 101997302 missense probably benign 0.18
R4923:Cpsf2 UTSW 12 101981984 missense probably benign
R4975:Cpsf2 UTSW 12 101983493 missense probably damaging 1.00
R5239:Cpsf2 UTSW 12 101987273 nonsense probably null
R5440:Cpsf2 UTSW 12 101996879 missense probably benign
R5601:Cpsf2 UTSW 12 101985355 splice site probably null
R5603:Cpsf2 UTSW 12 101998631 missense probably benign 0.02
R5841:Cpsf2 UTSW 12 101985238 missense probably damaging 0.99
R6153:Cpsf2 UTSW 12 101999360 splice site probably null
R6663:Cpsf2 UTSW 12 101999593 missense probably damaging 1.00
V8831:Cpsf2 UTSW 12 102003141 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTATCTTGAAGAGGTGGTCC -3'
(R):5'- TGCTGAACCGGTCACATTAAC -3'

Sequencing Primer
(F):5'- ATCTTGAAGAGGTGGTCCTTGTTAG -3'
(R):5'- TACATGTACCCTGTGGCAAG -3'
Posted On2015-03-18