Incidental Mutation 'R3733:Fbxl21'
ID271100
Institutional Source Beutler Lab
Gene Symbol Fbxl21
Ensembl Gene ENSMUSG00000035509
Gene NameF-box and leucine-rich repeat protein 21
SynonymsD630045D17Rik, FBL3B, FBXL3B, Psttm
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3733 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location56522472-56537898 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56527017 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 60 (H60Q)
Ref Sequence ENSEMBL: ENSMUSP00000112714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045428] [ENSMUST00000121095] [ENSMUST00000121871] [ENSMUST00000124981] [ENSMUST00000128668]
Predicted Effect probably benign
Transcript: ENSMUST00000045428
AA Change: H34Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035248
Gene: ENSMUSG00000035509
AA Change: H34Q

DomainStartEndE-ValueType
FBOX 45 85 4.77e-11 SMART
SCOP:d1a4ya_ 177 398 3e-3 SMART
Blast:LRR 203 228 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000121095
AA Change: H60Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112714
Gene: ENSMUSG00000035509
AA Change: H60Q

DomainStartEndE-ValueType
FBOX 71 111 4.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121871
AA Change: H60Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000112518
Gene: ENSMUSG00000035509
AA Change: H60Q

DomainStartEndE-ValueType
FBOX 71 111 4.77e-11 SMART
SCOP:d1a4ya_ 203 424 2e-3 SMART
Blast:LRR 229 254 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000124981
Predicted Effect probably benign
Transcript: ENSMUST00000128668
Meta Mutation Damage Score 0.286 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains 6 tandem leucine-rich repeats. The amino acid sequence of this protein is highly similar to that of f-box and leucine-rich repeat protein 3A. An allelic polymorphism in this gene results in both coding and non-coding variants; the reference genome represents the non-coding allele. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice with a point mutation exhibit a short circadian free-running period in constant darkness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik C T 11: 101,988,452 Q17* probably null Het
Ablim1 A T 19: 57,049,460 probably null Het
Adgrl3 C A 5: 81,794,946 H1474Q probably benign Het
Adgrv1 T C 13: 81,556,956 I1578M probably damaging Het
Bcl7b A G 5: 135,180,913 T141A probably benign Het
Chrna3 T C 9: 55,015,894 K210R probably benign Het
Cpsf2 T C 12: 101,987,308 I199T probably damaging Het
Cyp2a4 A G 7: 26,312,827 D345G probably damaging Het
Cyp2s1 C T 7: 25,803,954 R424Q probably null Het
D1Pas1 C A 1: 186,968,097 S74R probably benign Het
Edem1 T C 6: 108,841,621 F197L probably damaging Het
Ergic2 T C 6: 148,202,522 D79G probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 T C 8: 44,953,269 V1019A possibly damaging Het
Fbxw7 A C 3: 84,925,707 K19Q possibly damaging Het
Gldn A G 9: 54,338,662 K499R possibly damaging Het
Gria4 C T 9: 4,513,295 M271I probably benign Het
Herc1 C T 9: 66,445,640 T2136I probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Iqcg G T 16: 33,053,626 probably benign Het
Itih2 A T 2: 10,105,670 F537I probably benign Het
Itpr2 T C 6: 146,382,700 D533G probably damaging Het
Lag3 A T 6: 124,910,140 S155T probably benign Het
Lars T C 18: 42,212,602 E1003G probably benign Het
Layn T A 9: 51,059,544 N233I probably damaging Het
Lgi1 T C 19: 38,306,246 Y465H probably damaging Het
Lrig1 C T 6: 94,611,576 A531T possibly damaging Het
Mrps18b G A 17: 35,910,867 P97S probably damaging Het
Mtx2 C A 2: 74,847,262 A22E probably damaging Het
Nipal3 T C 4: 135,463,846 T325A probably damaging Het
Ola1 G C 2: 73,156,860 R143G probably damaging Het
Otog A G 7: 46,288,368 T1834A probably benign Het
Panx1 GTTCTTCT GTTCT 9: 15,006,171 probably benign Het
Pcdh18 T C 3: 49,754,791 S692G probably benign Het
Pkd2 G A 5: 104,489,419 probably null Het
Robo2 A C 16: 73,920,747 L1159W possibly damaging Het
Sfxn5 T C 6: 85,299,276 probably benign Het
Siah2 A G 3: 58,676,250 V205A probably damaging Het
Spindoc A C 19: 7,374,301 L202R probably damaging Het
Spock3 T A 8: 63,345,699 D251E probably damaging Het
Stk4 T A 2: 164,088,908 M143K probably benign Het
Trpc3 A T 3: 36,638,559 D761E probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wapl G A 14: 34,736,764 V928I probably damaging Het
Zfand3 A G 17: 30,192,656 K130R probably benign Het
Other mutations in Fbxl21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Fbxl21 APN 13 56527709 splice site probably benign
IGL01972:Fbxl21 APN 13 56536859 nonsense probably null
IGL02450:Fbxl21 APN 13 56526953 missense possibly damaging 0.52
IGL02667:Fbxl21 APN 13 56537129 missense probably benign 0.07
IGL02945:Fbxl21 APN 13 56527170 missense probably damaging 1.00
R1535:Fbxl21 UTSW 13 56523527 start codon destroyed probably benign 0.01
R1741:Fbxl21 UTSW 13 56537102 missense probably benign 0.06
R1863:Fbxl21 UTSW 13 56527063 missense probably benign 0.01
R1886:Fbxl21 UTSW 13 56527093 missense probably benign 0.24
R3176:Fbxl21 UTSW 13 56537122 nonsense probably null
R3276:Fbxl21 UTSW 13 56537122 nonsense probably null
R3732:Fbxl21 UTSW 13 56527017 missense probably benign 0.01
R3732:Fbxl21 UTSW 13 56527017 missense probably benign 0.01
R4535:Fbxl21 UTSW 13 56527060 missense probably damaging 0.99
R4678:Fbxl21 UTSW 13 56537049 missense probably damaging 1.00
R5264:Fbxl21 UTSW 13 56532323 missense probably benign 0.17
R5640:Fbxl21 UTSW 13 56537381 missense probably benign 0.23
R5714:Fbxl21 UTSW 13 56527072 missense probably benign 0.29
R6640:Fbxl21 UTSW 13 56537009 missense probably damaging 1.00
R6989:Fbxl21 UTSW 13 56527061 missense probably damaging 1.00
R7140:Fbxl21 UTSW 13 56532332 missense probably damaging 1.00
R7180:Fbxl21 UTSW 13 56523527 start codon destroyed probably benign 0.01
X0019:Fbxl21 UTSW 13 56532429 missense possibly damaging 0.82
X0026:Fbxl21 UTSW 13 56527112 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTGGAATGTAAGATGACTGC -3'
(R):5'- TGGTTCAGCTCAAACTCAAACTTC -3'

Sequencing Primer
(F):5'- GTAAGATGACTGCTAGAATTGTGTC -3'
(R):5'- CTTCCTCCAAAGATCAGGGATGTG -3'
Posted On2015-03-18