Incidental Mutation 'R3733:Lars'
ID271108
Institutional Source Beutler Lab
Gene Symbol Lars
Ensembl Gene ENSMUSG00000024493
Gene Nameleucyl-tRNA synthetase
Synonyms2310045K21Rik, 3110009L02Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #R3733 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location42202350-42262122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42212602 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1003 (E1003G)
Ref Sequence ENSEMBL: ENSMUSP00000095197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097590]
Predicted Effect probably benign
Transcript: ENSMUST00000097590
AA Change: E1003G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000095197
Gene: ENSMUSG00000024493
AA Change: E1003G

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 19 112 5.8e-12 PFAM
Pfam:tRNA-synt_1g 48 114 3.5e-7 PFAM
low complexity region 141 157 N/A INTRINSIC
Pfam:tRNA-synt_1 173 758 3.6e-26 PFAM
Pfam:tRNA-synt_1g 632 764 1e-9 PFAM
Pfam:tRNA-synt_1e 660 761 2.8e-7 PFAM
Pfam:Anticodon_1 796 930 3e-18 PFAM
Blast:IL1 950 1086 4e-37 BLAST
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic leucine-tRNA synthetase, a member of the class I aminoacyl-tRNA synthetase family. The encoded enzyme catalyzes the ATP-dependent ligation of L-leucine to tRNA(Leu). It is found in the cytoplasm as part of a multisynthetase complex and interacts with the arginine tRNA synthetase through its C-terminal domain. A mutation in this gene was found in affected individuals with infantile liver failure syndrome 1. Alternatively spliced transcript variants of this gene have been observed. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik C T 11: 101,988,452 Q17* probably null Het
Ablim1 A T 19: 57,049,460 probably null Het
Adgrl3 C A 5: 81,794,946 H1474Q probably benign Het
Adgrv1 T C 13: 81,556,956 I1578M probably damaging Het
Bcl7b A G 5: 135,180,913 T141A probably benign Het
Chrna3 T C 9: 55,015,894 K210R probably benign Het
Cpsf2 T C 12: 101,987,308 I199T probably damaging Het
Cyp2a4 A G 7: 26,312,827 D345G probably damaging Het
Cyp2s1 C T 7: 25,803,954 R424Q probably null Het
D1Pas1 C A 1: 186,968,097 S74R probably benign Het
Edem1 T C 6: 108,841,621 F197L probably damaging Het
Ergic2 T C 6: 148,202,522 D79G probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 T C 8: 44,953,269 V1019A possibly damaging Het
Fbxl21 T A 13: 56,527,017 H60Q probably benign Het
Fbxw7 A C 3: 84,925,707 K19Q possibly damaging Het
Gldn A G 9: 54,338,662 K499R possibly damaging Het
Gria4 C T 9: 4,513,295 M271I probably benign Het
Herc1 C T 9: 66,445,640 T2136I probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Iqcg G T 16: 33,053,626 probably benign Het
Itih2 A T 2: 10,105,670 F537I probably benign Het
Itpr2 T C 6: 146,382,700 D533G probably damaging Het
Lag3 A T 6: 124,910,140 S155T probably benign Het
Layn T A 9: 51,059,544 N233I probably damaging Het
Lgi1 T C 19: 38,306,246 Y465H probably damaging Het
Lrig1 C T 6: 94,611,576 A531T possibly damaging Het
Mrps18b G A 17: 35,910,867 P97S probably damaging Het
Mtx2 C A 2: 74,847,262 A22E probably damaging Het
Nipal3 T C 4: 135,463,846 T325A probably damaging Het
Ola1 G C 2: 73,156,860 R143G probably damaging Het
Otog A G 7: 46,288,368 T1834A probably benign Het
Panx1 GTTCTTCT GTTCT 9: 15,006,171 probably benign Het
Pcdh18 T C 3: 49,754,791 S692G probably benign Het
Pkd2 G A 5: 104,489,419 probably null Het
Robo2 A C 16: 73,920,747 L1159W possibly damaging Het
Sfxn5 T C 6: 85,299,276 probably benign Het
Siah2 A G 3: 58,676,250 V205A probably damaging Het
Spindoc A C 19: 7,374,301 L202R probably damaging Het
Spock3 T A 8: 63,345,699 D251E probably damaging Het
Stk4 T A 2: 164,088,908 M143K probably benign Het
Trpc3 A T 3: 36,638,559 D761E probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wapl G A 14: 34,736,764 V928I probably damaging Het
Zfand3 A G 17: 30,192,656 K130R probably benign Het
Other mutations in Lars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Lars APN 18 42229654 missense probably damaging 0.99
IGL01340:Lars APN 18 42202577 missense probably benign 0.01
IGL01397:Lars APN 18 42228029 missense probably damaging 1.00
IGL01510:Lars APN 18 42242109 missense probably benign
IGL01542:Lars APN 18 42214827 missense probably benign 0.09
IGL01689:Lars APN 18 42216949 missense probably benign
IGL01819:Lars APN 18 42202550 missense probably benign 0.00
IGL02142:Lars APN 18 42227280 missense probably benign 0.01
IGL02598:Lars APN 18 42227277 missense possibly damaging 0.61
IGL02630:Lars APN 18 42257169 missense probably damaging 0.97
IGL02973:Lars APN 18 42214759 critical splice donor site probably null
IGL03064:Lars APN 18 42221571 nonsense probably null
IGL03081:Lars APN 18 42210091 missense probably benign 0.00
IGL03330:Lars APN 18 42219944 missense probably benign
IGL03334:Lars APN 18 42221506 missense probably benign
IGL03340:Lars APN 18 42228650 splice site probably benign
R0165:Lars UTSW 18 42202697 missense possibly damaging 0.91
R0321:Lars UTSW 18 42202632 missense probably damaging 0.96
R0325:Lars UTSW 18 42250902 missense possibly damaging 0.88
R0391:Lars UTSW 18 42251363 missense probably benign 0.00
R0558:Lars UTSW 18 42214837 missense probably benign
R0624:Lars UTSW 18 42242784 splice site probably benign
R0881:Lars UTSW 18 42214786 missense probably benign 0.22
R0968:Lars UTSW 18 42218583 missense probably benign 0.09
R1457:Lars UTSW 18 42210050 missense probably damaging 1.00
R1466:Lars UTSW 18 42210050 missense probably damaging 1.00
R1466:Lars UTSW 18 42210050 missense probably damaging 1.00
R1583:Lars UTSW 18 42210050 missense probably damaging 1.00
R1584:Lars UTSW 18 42210050 missense probably damaging 1.00
R1851:Lars UTSW 18 42212608 missense probably benign 0.09
R1852:Lars UTSW 18 42212608 missense probably benign 0.09
R1868:Lars UTSW 18 42214837 missense probably benign 0.04
R1954:Lars UTSW 18 42210050 missense probably damaging 1.00
R2277:Lars UTSW 18 42235502 missense probably benign 0.00
R3732:Lars UTSW 18 42212602 missense probably benign 0.00
R3732:Lars UTSW 18 42212602 missense probably benign 0.00
R4208:Lars UTSW 18 42229703 missense probably benign 0.34
R4571:Lars UTSW 18 42228230 splice site probably null
R5009:Lars UTSW 18 42221547 missense probably benign 0.03
R5033:Lars UTSW 18 42214776 missense possibly damaging 0.92
R5152:Lars UTSW 18 42228777 missense possibly damaging 0.96
R5208:Lars UTSW 18 42217557 missense probably benign
R5219:Lars UTSW 18 42234720 missense probably benign 0.44
R5396:Lars UTSW 18 42216959 missense probably benign
R5433:Lars UTSW 18 42251298 missense possibly damaging 0.66
R5580:Lars UTSW 18 42214851 missense probably damaging 0.98
R5610:Lars UTSW 18 42257091 missense probably benign
R5784:Lars UTSW 18 42219899 missense probably benign 0.00
R6249:Lars UTSW 18 42257206 splice site probably null
R6334:Lars UTSW 18 42217486 missense probably benign
R6618:Lars UTSW 18 42244908 missense possibly damaging 0.86
R6900:Lars UTSW 18 42234610 missense probably benign
R6958:Lars UTSW 18 42236639 missense probably damaging 1.00
X0064:Lars UTSW 18 42228060 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTGCTCTAAAGACAATCTAGGGAG -3'
(R):5'- CTGAAAACTCTACGCTTTCTAGTC -3'

Sequencing Primer
(F):5'- GGCCCATGTGTTATGTGTAAGATAAC -3'
(R):5'- AAAACTCTACGCTTTCTAGTCTTTTC -3'
Posted On2015-03-18