Incidental Mutation 'R3744:Lyg1'
ID271112
Institutional Source Beutler Lab
Gene Symbol Lyg1
Ensembl Gene ENSMUSG00000026085
Gene Namelysozyme G-like 1
Synonyms
MMRRC Submission 040730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.020) question?
Stock #R3744 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location37946736-37957759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37949842 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 99 (Y99C)
Ref Sequence ENSEMBL: ENSMUSP00000110544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027254] [ENSMUST00000114894]
Predicted Effect probably benign
Transcript: ENSMUST00000027254
AA Change: Y99C

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027254
Gene: ENSMUSG00000026085
AA Change: Y99C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SCOP:d153l__ 23 197 1e-47 SMART
PDB:154L|A 24 197 2e-48 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114894
AA Change: Y99C

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110544
Gene: ENSMUSG00000026085
AA Change: Y99C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SCOP:d153l__ 23 197 8e-48 SMART
PDB:154L|A 24 197 1e-48 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144184
Meta Mutation Damage Score 0.1936 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,111,216 probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
BC004004 A G 17: 29,301,449 *349W probably null Het
Elmo2 C T 2: 165,316,002 D39N probably damaging Het
Fam161a T C 11: 23,020,410 F196S probably damaging Het
Fam186a A G 15: 99,947,535 V276A unknown Het
Fn3krp T C 11: 121,426,705 probably null Het
Gnai3 T C 3: 108,109,398 probably benign Het
Hspg2 C T 4: 137,565,504 probably benign Het
Igkv5-45 G A 6: 69,775,937 H54Y probably benign Het
Kif26b A G 1: 178,679,030 I224V probably benign Het
Myh4 C T 11: 67,255,315 R1400C probably damaging Het
Nf1 T C 11: 79,548,747 S2262P probably benign Het
Pop5 T C 5: 115,240,508 Y117H possibly damaging Het
Prpf8 T A 11: 75,506,721 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rapgef6 T C 11: 54,625,934 F54S probably benign Het
Sptb T C 12: 76,600,400 T1954A probably benign Het
Ssbp2 T C 13: 91,680,646 probably benign Het
Tap1 A T 17: 34,193,612 D541V probably damaging Het
Tcte1 A G 17: 45,539,671 D291G probably damaging Het
Tpbg A G 9: 85,845,162 R395G probably damaging Het
Trappc10 T A 10: 78,199,090 S941C probably benign Het
Usp19 G A 9: 108,500,181 R886Q probably damaging Het
Utp14b G T 1: 78,665,256 E290D probably benign Het
Vmn1r30 A T 6: 58,435,819 Y9* probably null Het
Vmn2r97 A G 17: 18,929,628 H426R probably benign Het
Vwa3a A G 7: 120,752,594 D27G probably benign Het
Zfp36 A G 7: 28,377,776 S236P probably benign Het
Zfp616 C A 11: 74,083,987 H452N probably benign Het
Other mutations in Lyg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Lyg1 APN 1 37949930 missense probably damaging 1.00
IGL03095:Lyg1 APN 1 37950768 splice site probably benign
R0411:Lyg1 UTSW 1 37949896 missense possibly damaging 0.92
R1171:Lyg1 UTSW 1 37947224 missense probably damaging 1.00
R2126:Lyg1 UTSW 1 37950674 missense probably damaging 0.96
R3715:Lyg1 UTSW 1 37950678 missense probably damaging 0.96
R4660:Lyg1 UTSW 1 37946861 utr 3 prime probably benign
R5040:Lyg1 UTSW 1 37950811 intron probably benign
R5769:Lyg1 UTSW 1 37950750 missense unknown
R5792:Lyg1 UTSW 1 37947267 missense probably benign 0.00
R5800:Lyg1 UTSW 1 37946953 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCACGTGGCATGCATGTG -3'
(R):5'- ACTTGGGGTTTTCAGTCACAC -3'

Sequencing Primer
(F):5'- ACACCACCGTAATTGGGTTG -3'
(R):5'- GGGGTTTTCAGTCACACTTCTAAGC -3'
Posted On2015-03-18