Incidental Mutation 'R3744:Utp14b'
ID271114
Institutional Source Beutler Lab
Gene Symbol Utp14b
Ensembl Gene ENSMUSG00000079470
Gene NameUTP14B small subunit processome component
Synonyms4932411L21Rik, jsd
MMRRC Submission 040730-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3744 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location78658038-78671512 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 78665256 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 290 (E290D)
Ref Sequence ENSEMBL: ENSMUSP00000121391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035779] [ENSMUST00000053760] [ENSMUST00000134566] [ENSMUST00000142704] [ENSMUST00000151622]
Predicted Effect probably benign
Transcript: ENSMUST00000035779
SMART Domains Protein: ENSMUSP00000045291
Gene: ENSMUSG00000032883

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053760
AA Change: E290D

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000052149
Gene: ENSMUSG00000079470
AA Change: E290D

DomainStartEndE-ValueType
Pfam:Utp14 39 744 6.4e-205 PFAM
low complexity region 758 778 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134566
SMART Domains Protein: ENSMUSP00000117952
Gene: ENSMUSG00000032883

DomainStartEndE-ValueType
Pfam:AMP-binding 1 435 4.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142704
SMART Domains Protein: ENSMUSP00000121695
Gene: ENSMUSG00000032883

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2.5e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151622
AA Change: E290D

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000121391
Gene: ENSMUSG00000079470
AA Change: E290D

DomainStartEndE-ValueType
Pfam:Utp14 45 743 6e-163 PFAM
low complexity region 758 778 N/A INTRINSIC
Meta Mutation Damage Score 0.23 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (33/33)
MGI Phenotype PHENOTYPE: Homozygous males are sterile with spermatogonial arrest and elevated intratesticular testosterone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,111,216 probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
BC004004 A G 17: 29,301,449 *349W probably null Het
Elmo2 C T 2: 165,316,002 D39N probably damaging Het
Fam161a T C 11: 23,020,410 F196S probably damaging Het
Fam186a A G 15: 99,947,535 V276A unknown Het
Fn3krp T C 11: 121,426,705 probably null Het
Gnai3 T C 3: 108,109,398 probably benign Het
Hspg2 C T 4: 137,565,504 probably benign Het
Igkv5-45 G A 6: 69,775,937 H54Y probably benign Het
Kif26b A G 1: 178,679,030 I224V probably benign Het
Lyg1 T C 1: 37,949,842 Y99C probably benign Het
Myh4 C T 11: 67,255,315 R1400C probably damaging Het
Nf1 T C 11: 79,548,747 S2262P probably benign Het
Pop5 T C 5: 115,240,508 Y117H possibly damaging Het
Prpf8 T A 11: 75,506,721 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rapgef6 T C 11: 54,625,934 F54S probably benign Het
Sptb T C 12: 76,600,400 T1954A probably benign Het
Ssbp2 T C 13: 91,680,646 probably benign Het
Tap1 A T 17: 34,193,612 D541V probably damaging Het
Tcte1 A G 17: 45,539,671 D291G probably damaging Het
Tpbg A G 9: 85,845,162 R395G probably damaging Het
Trappc10 T A 10: 78,199,090 S941C probably benign Het
Usp19 G A 9: 108,500,181 R886Q probably damaging Het
Vmn1r30 A T 6: 58,435,819 Y9* probably null Het
Vmn2r97 A G 17: 18,929,628 H426R probably benign Het
Vwa3a A G 7: 120,752,594 D27G probably benign Het
Zfp36 A G 7: 28,377,776 S236P probably benign Het
Zfp616 C A 11: 74,083,987 H452N probably benign Het
Other mutations in Utp14b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Utp14b APN 1 78664545 missense probably damaging 1.00
IGL01837:Utp14b APN 1 78664919 missense probably damaging 1.00
IGL02895:Utp14b APN 1 78664607 missense possibly damaging 0.61
IGL03165:Utp14b APN 1 78664520 missense probably damaging 0.97
IGL03210:Utp14b APN 1 78665551 missense probably benign 0.02
R0662:Utp14b UTSW 1 78664999 missense probably damaging 1.00
R0671:Utp14b UTSW 1 78664735 missense probably benign 0.00
R0736:Utp14b UTSW 1 78665272 missense probably damaging 1.00
R1180:Utp14b UTSW 1 78665445 missense probably damaging 1.00
R1430:Utp14b UTSW 1 78666394 missense probably benign 0.25
R1448:Utp14b UTSW 1 78665445 missense probably damaging 1.00
R1641:Utp14b UTSW 1 78665939 missense probably benign 0.08
R1867:Utp14b UTSW 1 78665431 missense probably damaging 1.00
R3054:Utp14b UTSW 1 78664725 missense possibly damaging 0.91
R3055:Utp14b UTSW 1 78664725 missense possibly damaging 0.91
R3056:Utp14b UTSW 1 78664725 missense possibly damaging 0.91
R3426:Utp14b UTSW 1 78665339 missense probably damaging 1.00
R4204:Utp14b UTSW 1 78664822 missense probably benign 0.12
R5570:Utp14b UTSW 1 78665401 missense probably damaging 1.00
R5574:Utp14b UTSW 1 78666409 missense probably damaging 1.00
R5958:Utp14b UTSW 1 78664942 nonsense probably null
R5958:Utp14b UTSW 1 78664943 missense probably damaging 1.00
R6173:Utp14b UTSW 1 78665837 missense probably benign 0.03
R6173:Utp14b UTSW 1 78665840 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGGAAACAGCCTCCATCAGAG -3'
(R):5'- ACTACCTGGAGTTTCTGTGTCAG -3'

Sequencing Primer
(F):5'- TCCATCAGAGCCATGAGCCTG -3'
(R):5'- AGCCAATTGTTCTTGCATAGC -3'
Posted On2015-03-18