Incidental Mutation 'R3744:Vmn1r30'
ID271120
Institutional Source Beutler Lab
Gene Symbol Vmn1r30
Ensembl Gene ENSMUSG00000095670
Gene Namevomeronasal 1 receptor 30
SynonymsV1rc9, V1rc22
MMRRC Submission 040730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R3744 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location58434159-58443385 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 58435819 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 9 (Y9*)
Ref Sequence ENSEMBL: ENSMUSP00000154098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078890] [ENSMUST00000226334] [ENSMUST00000227466] [ENSMUST00000228577] [ENSMUST00000228635]
Predicted Effect probably null
Transcript: ENSMUST00000078890
AA Change: Y9*
SMART Domains Protein: ENSMUSP00000087336
Gene: ENSMUSG00000095670
AA Change: Y9*

DomainStartEndE-ValueType
Pfam:V1R 29 293 4.8e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203463
Predicted Effect probably null
Transcript: ENSMUST00000226334
AA Change: Y9*
Predicted Effect probably null
Transcript: ENSMUST00000227466
AA Change: Y9*
Predicted Effect probably null
Transcript: ENSMUST00000228577
AA Change: Y9*
Predicted Effect probably null
Transcript: ENSMUST00000228635
AA Change: Y9*
Meta Mutation Damage Score 0.6156 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,111,216 probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
BC004004 A G 17: 29,301,449 *349W probably null Het
Elmo2 C T 2: 165,316,002 D39N probably damaging Het
Fam161a T C 11: 23,020,410 F196S probably damaging Het
Fam186a A G 15: 99,947,535 V276A unknown Het
Fn3krp T C 11: 121,426,705 probably null Het
Gnai3 T C 3: 108,109,398 probably benign Het
Hspg2 C T 4: 137,565,504 probably benign Het
Igkv5-45 G A 6: 69,775,937 H54Y probably benign Het
Kif26b A G 1: 178,679,030 I224V probably benign Het
Lyg1 T C 1: 37,949,842 Y99C probably benign Het
Myh4 C T 11: 67,255,315 R1400C probably damaging Het
Nf1 T C 11: 79,548,747 S2262P probably benign Het
Pop5 T C 5: 115,240,508 Y117H possibly damaging Het
Prpf8 T A 11: 75,506,721 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rapgef6 T C 11: 54,625,934 F54S probably benign Het
Sptb T C 12: 76,600,400 T1954A probably benign Het
Ssbp2 T C 13: 91,680,646 probably benign Het
Tap1 A T 17: 34,193,612 D541V probably damaging Het
Tcte1 A G 17: 45,539,671 D291G probably damaging Het
Tpbg A G 9: 85,845,162 R395G probably damaging Het
Trappc10 T A 10: 78,199,090 S941C probably benign Het
Usp19 G A 9: 108,500,181 R886Q probably damaging Het
Utp14b G T 1: 78,665,256 E290D probably benign Het
Vmn2r97 A G 17: 18,929,628 H426R probably benign Het
Vwa3a A G 7: 120,752,594 D27G probably benign Het
Zfp36 A G 7: 28,377,776 S236P probably benign Het
Zfp616 C A 11: 74,083,987 H452N probably benign Het
Other mutations in Vmn1r30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01657:Vmn1r30 APN 6 58435634 missense probably benign 0.01
IGL02432:Vmn1r30 APN 6 58435670 missense probably benign 0.04
IGL02627:Vmn1r30 APN 6 58435761 missense probably benign 0.08
IGL02870:Vmn1r30 APN 6 58435370 missense probably benign 0.01
R0360:Vmn1r30 UTSW 6 58435277 missense probably benign 0.03
R1071:Vmn1r30 UTSW 6 58435828 missense possibly damaging 0.93
R1335:Vmn1r30 UTSW 6 58435095 missense probably damaging 1.00
R1888:Vmn1r30 UTSW 6 58435490 missense possibly damaging 0.93
R1888:Vmn1r30 UTSW 6 58435490 missense possibly damaging 0.93
R2483:Vmn1r30 UTSW 6 58435452 missense probably benign 0.02
R3622:Vmn1r30 UTSW 6 58435452 missense probably benign 0.02
R3623:Vmn1r30 UTSW 6 58435452 missense probably benign 0.02
R3624:Vmn1r30 UTSW 6 58435452 missense probably benign 0.02
R3762:Vmn1r30 UTSW 6 58435293 missense probably benign 0.20
R4483:Vmn1r30 UTSW 6 58435133 missense probably damaging 1.00
R4484:Vmn1r30 UTSW 6 58435133 missense probably damaging 1.00
R5160:Vmn1r30 UTSW 6 58435383 missense probably benign 0.03
R5408:Vmn1r30 UTSW 6 58435044 missense probably benign 0.03
R5461:Vmn1r30 UTSW 6 58435774 nonsense probably null
R5888:Vmn1r30 UTSW 6 58435565 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACTCAAGTATGACTGCAAGCC -3'
(R):5'- AGGTGCATGAGACAAAGTGTTC -3'

Sequencing Primer
(F):5'- GTATGACTGCAAGCCAATTATCC -3'
(R):5'- CACGTCCAATATGCTCTTAA -3'
Posted On2015-03-18