Incidental Mutation 'R3744:Zfp36'
ID271121
Institutional Source Beutler Lab
Gene Symbol Zfp36
Ensembl Gene ENSMUSG00000044786
Gene Namezinc finger protein 36
SynonymsTis11, Ttp, Zfp-36, Tristetraprolin, Nup475
MMRRC Submission 040730-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.856) question?
Stock #R3744 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location28376784-28380253 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28377776 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 236 (S236P)
Ref Sequence ENSEMBL: ENSMUSP00000146830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051241] [ENSMUST00000209061]
Predicted Effect probably benign
Transcript: ENSMUST00000051241
AA Change: S248P

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000057815
Gene: ENSMUSG00000044786
AA Change: S248P

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
ZnF_C3H1 95 122 7.54e-10 SMART
ZnF_C3H1 133 160 7.31e-8 SMART
low complexity region 178 222 N/A INTRINSIC
low complexity region 279 289 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208885
Predicted Effect probably benign
Transcript: ENSMUST00000209061
AA Change: S236P

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
Meta Mutation Damage Score 0.1276 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (33/33)
MGI Phenotype PHENOTYPE: Homozygotes are normal at birth but soon develop myeloid hyperplasia, cachexia, patchy alopecia, dermatitis, arthritis, loss of adiposity, conjunctivitis, glomerular mesangial thickening and autoimmunity, with variable severity. All aspects of the syndrome are normalized by TNF antibody treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,111,216 probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
BC004004 A G 17: 29,301,449 *349W probably null Het
Elmo2 C T 2: 165,316,002 D39N probably damaging Het
Fam161a T C 11: 23,020,410 F196S probably damaging Het
Fam186a A G 15: 99,947,535 V276A unknown Het
Fn3krp T C 11: 121,426,705 probably null Het
Gnai3 T C 3: 108,109,398 probably benign Het
Hspg2 C T 4: 137,565,504 probably benign Het
Igkv5-45 G A 6: 69,775,937 H54Y probably benign Het
Kif26b A G 1: 178,679,030 I224V probably benign Het
Lyg1 T C 1: 37,949,842 Y99C probably benign Het
Myh4 C T 11: 67,255,315 R1400C probably damaging Het
Nf1 T C 11: 79,548,747 S2262P probably benign Het
Pop5 T C 5: 115,240,508 Y117H possibly damaging Het
Prpf8 T A 11: 75,506,721 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rapgef6 T C 11: 54,625,934 F54S probably benign Het
Sptb T C 12: 76,600,400 T1954A probably benign Het
Ssbp2 T C 13: 91,680,646 probably benign Het
Tap1 A T 17: 34,193,612 D541V probably damaging Het
Tcte1 A G 17: 45,539,671 D291G probably damaging Het
Tpbg A G 9: 85,845,162 R395G probably damaging Het
Trappc10 T A 10: 78,199,090 S941C probably benign Het
Usp19 G A 9: 108,500,181 R886Q probably damaging Het
Utp14b G T 1: 78,665,256 E290D probably benign Het
Vmn1r30 A T 6: 58,435,819 Y9* probably null Het
Vmn2r97 A G 17: 18,929,628 H426R probably benign Het
Vwa3a A G 7: 120,752,594 D27G probably benign Het
Zfp616 C A 11: 74,083,987 H452N probably benign Het
Other mutations in Zfp36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:Zfp36 APN 7 28378463 missense probably damaging 0.99
IGL02094:Zfp36 APN 7 28377763 missense probably benign
R0241:Zfp36 UTSW 7 28378334 missense probably damaging 0.96
R0241:Zfp36 UTSW 7 28378334 missense probably damaging 0.96
R0288:Zfp36 UTSW 7 28378241 missense probably benign
R1941:Zfp36 UTSW 7 28377646 missense probably damaging 0.98
R3625:Zfp36 UTSW 7 28378256 missense probably benign 0.00
R4385:Zfp36 UTSW 7 28377691 missense probably benign 0.11
R5387:Zfp36 UTSW 7 28377868 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- AGGCACTTGTCACTCAGAGAC -3'
(R):5'- TGCTGCGACAAAGCATCAG -3'

Sequencing Primer
(F):5'- CTTGTCACTCAGAGACAGAGATACG -3'
(R):5'- GCATCAGCTTCTCCGGC -3'
Posted On2015-03-18