Incidental Mutation 'R3744:Tpbg'
ID271123
Institutional Source Beutler Lab
Gene Symbol Tpbg
Ensembl Gene ENSMUSG00000035274
Gene Nametrophoblast glycoprotein
Synonyms5T4 oncofetal antigen, 5T4
MMRRC Submission 040730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R3744 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location85842380-85847040 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85845162 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 395 (R395G)
Ref Sequence ENSEMBL: ENSMUSP00000096101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006559] [ENSMUST00000098500]
Predicted Effect probably damaging
Transcript: ENSMUST00000006559
AA Change: R395G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006559
Gene: ENSMUSG00000035274
AA Change: R395G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LRRNT 61 95 1.27e-6 SMART
LRR 94 113 1.53e2 SMART
LRR_TYP 117 140 1.92e-2 SMART
LRR_TYP 141 164 6.88e-4 SMART
LRR 215 238 6.22e0 SMART
LRR_TYP 239 262 2.2e-2 SMART
LRR 263 286 2.67e-1 SMART
LRRCT 300 351 9.1e-14 SMART
transmembrane domain 360 382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000069896
SMART Domains Protein: ENSMUSP00000126873
Gene: ENSMUSG00000056031

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 68 88 N/A INTRINSIC
low complexity region 103 122 N/A INTRINSIC
low complexity region 150 193 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098500
AA Change: R395G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096101
Gene: ENSMUSG00000035274
AA Change: R395G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LRRNT 61 95 1.27e-6 SMART
LRR 94 113 1.53e2 SMART
LRR_TYP 117 140 1.92e-2 SMART
LRR_TYP 141 164 6.88e-4 SMART
LRR 215 238 6.22e0 SMART
LRR_TYP 239 262 2.2e-2 SMART
LRR 263 286 2.67e-1 SMART
LRRCT 300 351 9.1e-14 SMART
transmembrane domain 360 382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189191
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich transmembrane glycoprotein that may be involved in cell adhesion. The encoded protein is an oncofetal antigen that is specific to trophoblast cells. In adults this protein is highly expressed in many tumor cells and is associated with poor clinical outcome in numerous cancers. Alternate splicing in the 5' UTR results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit low penetrance hydrocephaly and premature death. Embryonic stem cells isolated from these mice exhibit impaired mesenchyme differentiation and reduced chemotaxis following differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,111,216 probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
BC004004 A G 17: 29,301,449 *349W probably null Het
Elmo2 C T 2: 165,316,002 D39N probably damaging Het
Fam161a T C 11: 23,020,410 F196S probably damaging Het
Fam186a A G 15: 99,947,535 V276A unknown Het
Fn3krp T C 11: 121,426,705 probably null Het
Gnai3 T C 3: 108,109,398 probably benign Het
Hspg2 C T 4: 137,565,504 probably benign Het
Igkv5-45 G A 6: 69,775,937 H54Y probably benign Het
Kif26b A G 1: 178,679,030 I224V probably benign Het
Lyg1 T C 1: 37,949,842 Y99C probably benign Het
Myh4 C T 11: 67,255,315 R1400C probably damaging Het
Nf1 T C 11: 79,548,747 S2262P probably benign Het
Pop5 T C 5: 115,240,508 Y117H possibly damaging Het
Prpf8 T A 11: 75,506,721 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rapgef6 T C 11: 54,625,934 F54S probably benign Het
Sptb T C 12: 76,600,400 T1954A probably benign Het
Ssbp2 T C 13: 91,680,646 probably benign Het
Tap1 A T 17: 34,193,612 D541V probably damaging Het
Tcte1 A G 17: 45,539,671 D291G probably damaging Het
Trappc10 T A 10: 78,199,090 S941C probably benign Het
Usp19 G A 9: 108,500,181 R886Q probably damaging Het
Utp14b G T 1: 78,665,256 E290D probably benign Het
Vmn1r30 A T 6: 58,435,819 Y9* probably null Het
Vmn2r97 A G 17: 18,929,628 H426R probably benign Het
Vwa3a A G 7: 120,752,594 D27G probably benign Het
Zfp36 A G 7: 28,377,776 S236P probably benign Het
Zfp616 C A 11: 74,083,987 H452N probably benign Het
Other mutations in Tpbg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Tpbg APN 9 85844092 missense unknown
IGL01789:Tpbg APN 9 85844901 missense probably benign 0.00
IGL01987:Tpbg APN 9 85845199 missense probably damaging 1.00
R0399:Tpbg UTSW 9 85844938 missense possibly damaging 0.63
R0418:Tpbg UTSW 9 85844750 nonsense probably null
R0904:Tpbg UTSW 9 85844564 missense unknown
R1748:Tpbg UTSW 9 85844376 missense probably damaging 1.00
R3836:Tpbg UTSW 9 85843114 intron probably benign
R3837:Tpbg UTSW 9 85843114 intron probably benign
R3839:Tpbg UTSW 9 85843114 intron probably benign
R5221:Tpbg UTSW 9 85844425 missense probably damaging 1.00
R6488:Tpbg UTSW 9 85844485 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- GCGCATTCCCGGAGAAAATG -3'
(R):5'- TCAATAGTGTCTACGGTGAAGTG -3'

Sequencing Primer
(F):5'- GAGGAATCGTGGCCTCTTAGAC -3'
(R):5'- ATAGTGTCTACGGTGAAGTGTGGAAG -3'
Posted On2015-03-18