Incidental Mutation 'R3744:Fn3krp'
ID271132
Institutional Source Beutler Lab
Gene Symbol Fn3krp
Ensembl Gene ENSMUSG00000039253
Gene Namefructosamine 3 kinase related protein
Synonyms
MMRRC Submission 040730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R3744 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location121421401-121431288 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 121426705 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038096]
Predicted Effect probably null
Transcript: ENSMUST00000038096
SMART Domains Protein: ENSMUSP00000038061
Gene: ENSMUSG00000039253

DomainStartEndE-ValueType
Pfam:Fructosamin_kin 1 309 6e-81 PFAM
Pfam:APH 22 267 1.5e-12 PFAM
Meta Mutation Damage Score 0.52 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A high concentration of glucose can result in non-enzymatic oxidation of proteins by reaction of glucose and lysine residues (glycation). Proteins modified in this way are less active or functional. This gene encodes an enzyme which catalyzes the phosphorylation of psicosamines and ribulosamines compared to the neighboring gene which encodes a highly similar enzyme, fructosamine-3-kinase, which has different substrate specificity. The activity of both enzymes may result in deglycation of proteins to restore their function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,111,216 probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
BC004004 A G 17: 29,301,449 *349W probably null Het
Elmo2 C T 2: 165,316,002 D39N probably damaging Het
Fam161a T C 11: 23,020,410 F196S probably damaging Het
Fam186a A G 15: 99,947,535 V276A unknown Het
Gnai3 T C 3: 108,109,398 probably benign Het
Hspg2 C T 4: 137,565,504 probably benign Het
Igkv5-45 G A 6: 69,775,937 H54Y probably benign Het
Kif26b A G 1: 178,679,030 I224V probably benign Het
Lyg1 T C 1: 37,949,842 Y99C probably benign Het
Myh4 C T 11: 67,255,315 R1400C probably damaging Het
Nf1 T C 11: 79,548,747 S2262P probably benign Het
Pop5 T C 5: 115,240,508 Y117H possibly damaging Het
Prpf8 T A 11: 75,506,721 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rapgef6 T C 11: 54,625,934 F54S probably benign Het
Sptb T C 12: 76,600,400 T1954A probably benign Het
Ssbp2 T C 13: 91,680,646 probably benign Het
Tap1 A T 17: 34,193,612 D541V probably damaging Het
Tcte1 A G 17: 45,539,671 D291G probably damaging Het
Tpbg A G 9: 85,845,162 R395G probably damaging Het
Trappc10 T A 10: 78,199,090 S941C probably benign Het
Usp19 G A 9: 108,500,181 R886Q probably damaging Het
Utp14b G T 1: 78,665,256 E290D probably benign Het
Vmn1r30 A T 6: 58,435,819 Y9* probably null Het
Vmn2r97 A G 17: 18,929,628 H426R probably benign Het
Vwa3a A G 7: 120,752,594 D27G probably benign Het
Zfp36 A G 7: 28,377,776 S236P probably benign Het
Zfp616 C A 11: 74,083,987 H452N probably benign Het
Other mutations in Fn3krp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Fn3krp APN 11 121421554 missense probably damaging 1.00
IGL01633:Fn3krp APN 11 121429707 nonsense probably null
IGL02123:Fn3krp APN 11 121429444 missense probably benign 0.00
IGL03189:Fn3krp APN 11 121429630 missense probably damaging 1.00
R0278:Fn3krp UTSW 11 121421580 missense probably damaging 1.00
R1927:Fn3krp UTSW 11 121424977 missense probably damaging 0.99
R4471:Fn3krp UTSW 11 121426673 missense probably benign 0.01
R4850:Fn3krp UTSW 11 121425053 missense possibly damaging 0.56
R5027:Fn3krp UTSW 11 121429448 missense probably benign 0.01
R5162:Fn3krp UTSW 11 121429584 missense probably damaging 1.00
R5444:Fn3krp UTSW 11 121421604 critical splice donor site probably null
R6230:Fn3krp UTSW 11 121425592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAACCCTGAGCTGCAAGAG -3'
(R):5'- CAGATTTTAACCCCTCCTTGAAGAC -3'

Sequencing Primer
(F):5'- TGCAAGAGCGGACCCGAG -3'
(R):5'- TTGAAGACCAGCATCCTAACTTG -3'
Posted On2015-03-18