Incidental Mutation 'R3744:Aspn'
ID271135
Institutional Source Beutler Lab
Gene Symbol Aspn
Ensembl Gene ENSMUSG00000021388
Gene Nameasporin
SynonymsPLAP-1, 4631401G09Rik, SLRR1C
MMRRC Submission 040730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R3744 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location49544443-49567565 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 49566560 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 351 (E351K)
Ref Sequence ENSEMBL: ENSMUSP00000136728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021818] [ENSMUST00000021820] [ENSMUST00000177948]
Predicted Effect probably benign
Transcript: ENSMUST00000021818
SMART Domains Protein: ENSMUSP00000021818
Gene: ENSMUSG00000021391

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
Pfam:CENP-P 102 278 3.9e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000021820
AA Change: E351K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021820
Gene: ENSMUSG00000021388
AA Change: E351K

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
LRRNT 67 99 8.23e-6 SMART
LRR 98 117 3.36e2 SMART
LRR 118 141 2.49e-1 SMART
LRR 142 165 5.41e0 SMART
LRR 187 212 9.5e1 SMART
Blast:LRR 232 256 9e-6 BLAST
LRR 257 280 4.83e0 SMART
LRR 281 303 6.23e1 SMART
LRR 304 327 2.03e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177948
AA Change: E351K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136728
Gene: ENSMUSG00000021388
AA Change: E351K

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
LRRNT 67 99 8.23e-6 SMART
LRR 98 117 3.36e2 SMART
LRR 118 141 2.49e-1 SMART
LRR 142 165 5.41e0 SMART
LRR 187 212 9.5e1 SMART
Blast:LRR 232 256 9e-6 BLAST
LRR 257 280 4.83e0 SMART
LRR 281 303 6.23e1 SMART
LRR 304 327 2.03e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221751
Meta Mutation Damage Score 0.17 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: This gene encodes a member of the small leucine-rich proteoglycan family. The encoded protein is an extracellular matrix protein that modulates the transforming growth factor-beta signaling pathway, regulating cartilage matrix gene expression and cartilage formation. The protein plays a role in the pathology of osteoarthritis. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,111,216 probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
BC004004 A G 17: 29,301,449 *349W probably null Het
Elmo2 C T 2: 165,316,002 D39N probably damaging Het
Fam161a T C 11: 23,020,410 F196S probably damaging Het
Fam186a A G 15: 99,947,535 V276A unknown Het
Fn3krp T C 11: 121,426,705 probably null Het
Gnai3 T C 3: 108,109,398 probably benign Het
Hspg2 C T 4: 137,565,504 probably benign Het
Igkv5-45 G A 6: 69,775,937 H54Y probably benign Het
Kif26b A G 1: 178,679,030 I224V probably benign Het
Lyg1 T C 1: 37,949,842 Y99C probably benign Het
Myh4 C T 11: 67,255,315 R1400C probably damaging Het
Nf1 T C 11: 79,548,747 S2262P probably benign Het
Pop5 T C 5: 115,240,508 Y117H possibly damaging Het
Prpf8 T A 11: 75,506,721 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rapgef6 T C 11: 54,625,934 F54S probably benign Het
Sptb T C 12: 76,600,400 T1954A probably benign Het
Ssbp2 T C 13: 91,680,646 probably benign Het
Tap1 A T 17: 34,193,612 D541V probably damaging Het
Tcte1 A G 17: 45,539,671 D291G probably damaging Het
Tpbg A G 9: 85,845,162 R395G probably damaging Het
Trappc10 T A 10: 78,199,090 S941C probably benign Het
Usp19 G A 9: 108,500,181 R886Q probably damaging Het
Utp14b G T 1: 78,665,256 E290D probably benign Het
Vmn1r30 A T 6: 58,435,819 Y9* probably null Het
Vmn2r97 A G 17: 18,929,628 H426R probably benign Het
Vwa3a A G 7: 120,752,594 D27G probably benign Het
Zfp36 A G 7: 28,377,776 S236P probably benign Het
Zfp616 C A 11: 74,083,987 H452N probably benign Het
Other mutations in Aspn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Aspn APN 13 49566492 missense probably benign 0.06
IGL00796:Aspn APN 13 49557417 missense probably damaging 0.98
IGL01088:Aspn APN 13 49566553 missense probably benign 0.00
IGL02633:Aspn APN 13 49551887 missense possibly damaging 0.93
IGL03180:Aspn APN 13 49563515 missense probably damaging 1.00
R0699:Aspn UTSW 13 49551782 missense possibly damaging 0.63
R1445:Aspn UTSW 13 49557373 missense possibly damaging 0.75
R1749:Aspn UTSW 13 49551785 missense probably benign 0.01
R2907:Aspn UTSW 13 49551898 missense probably damaging 1.00
R3745:Aspn UTSW 13 49566560 missense probably damaging 0.96
R4625:Aspn UTSW 13 49557425 missense probably benign
R5061:Aspn UTSW 13 49566604 missense probably damaging 0.99
R5712:Aspn UTSW 13 49563519 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCCATGTTCCAGATAAAAC -3'
(R):5'- ACGCAAGAATCATTCATGTGCAG -3'

Sequencing Primer
(F):5'- CACATTTCTTTTTATATTTACCGGGC -3'
(R):5'- AATCATTCATGTGCAGAAGGAC -3'
Posted On2015-03-18