Incidental Mutation 'R3744:Ssbp2'
ID271137
Institutional Source Beutler Lab
Gene Symbol Ssbp2
Ensembl Gene ENSMUSG00000003992
Gene Namesingle-stranded DNA binding protein 2
SynonymsHspc116, 1500004K09Rik, 2310079I02Rik, 9330163K02Rik, A830008M03Rik
MMRRC Submission 040730-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.396) question?
Stock #R3744 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location91460283-91703429 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 91680646 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004094] [ENSMUST00000042122] [ENSMUST00000231481]
Predicted Effect probably benign
Transcript: ENSMUST00000004094
SMART Domains Protein: ENSMUSP00000004094
Gene: ENSMUSG00000003992

DomainStartEndE-ValueType
LisH 18 50 2.18e-3 SMART
Pfam:SSDP 83 125 5.9e-19 PFAM
Pfam:SSDP 123 338 5.3e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042122
SMART Domains Protein: ENSMUSP00000037115
Gene: ENSMUSG00000003992

DomainStartEndE-ValueType
LisH 18 50 2.18e-3 SMART
Pfam:SSDP 94 313 2.7e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156547
Predicted Effect probably benign
Transcript: ENSMUST00000231481
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a protein complex that interacts with single-stranded DNA and is involved in the DNA damage response and maintenance of genome stability. The encoded protein may also play a role in telomere repair. A variant of this gene may be associated with survival in human glioblastoma patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice exhibit some perinatal lethality and premature death associated with increased incidence of lymphoma and carcinoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,111,216 probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
BC004004 A G 17: 29,301,449 *349W probably null Het
Elmo2 C T 2: 165,316,002 D39N probably damaging Het
Fam161a T C 11: 23,020,410 F196S probably damaging Het
Fam186a A G 15: 99,947,535 V276A unknown Het
Fn3krp T C 11: 121,426,705 probably null Het
Gnai3 T C 3: 108,109,398 probably benign Het
Hspg2 C T 4: 137,565,504 probably benign Het
Igkv5-45 G A 6: 69,775,937 H54Y probably benign Het
Kif26b A G 1: 178,679,030 I224V probably benign Het
Lyg1 T C 1: 37,949,842 Y99C probably benign Het
Myh4 C T 11: 67,255,315 R1400C probably damaging Het
Nf1 T C 11: 79,548,747 S2262P probably benign Het
Pop5 T C 5: 115,240,508 Y117H possibly damaging Het
Prpf8 T A 11: 75,506,721 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rapgef6 T C 11: 54,625,934 F54S probably benign Het
Sptb T C 12: 76,600,400 T1954A probably benign Het
Tap1 A T 17: 34,193,612 D541V probably damaging Het
Tcte1 A G 17: 45,539,671 D291G probably damaging Het
Tpbg A G 9: 85,845,162 R395G probably damaging Het
Trappc10 T A 10: 78,199,090 S941C probably benign Het
Usp19 G A 9: 108,500,181 R886Q probably damaging Het
Utp14b G T 1: 78,665,256 E290D probably benign Het
Vmn1r30 A T 6: 58,435,819 Y9* probably null Het
Vmn2r97 A G 17: 18,929,628 H426R probably benign Het
Vwa3a A G 7: 120,752,594 D27G probably benign Het
Zfp36 A G 7: 28,377,776 S236P probably benign Het
Zfp616 C A 11: 74,083,987 H452N probably benign Het
Other mutations in Ssbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02656:Ssbp2 APN 13 91669752 splice site probably benign
IGL02962:Ssbp2 APN 13 91642371 missense possibly damaging 0.84
IGL03201:Ssbp2 APN 13 91524601 missense probably damaging 1.00
R0190:Ssbp2 UTSW 13 91669710 missense probably damaging 1.00
R0277:Ssbp2 UTSW 13 91564596 splice site probably benign
R0329:Ssbp2 UTSW 13 91680579 splice site probably null
R0330:Ssbp2 UTSW 13 91680579 splice site probably null
R1551:Ssbp2 UTSW 13 91642392 critical splice donor site probably null
R1846:Ssbp2 UTSW 13 91664149 missense probably damaging 1.00
R1957:Ssbp2 UTSW 13 91664184 splice site probably benign
R3732:Ssbp2 UTSW 13 91524607 missense probably damaging 1.00
R4469:Ssbp2 UTSW 13 91694056 missense probably damaging 1.00
R4665:Ssbp2 UTSW 13 91539335 missense possibly damaging 0.48
R4724:Ssbp2 UTSW 13 91688814 missense possibly damaging 0.70
R5477:Ssbp2 UTSW 13 91664125 missense probably damaging 0.98
R6015:Ssbp2 UTSW 13 91669743 critical splice donor site probably null
R6332:Ssbp2 UTSW 13 91690908 missense probably benign 0.01
R6523:Ssbp2 UTSW 13 91693051 missense probably benign 0.09
R6548:Ssbp2 UTSW 13 91539351 missense possibly damaging 0.91
R6655:Ssbp2 UTSW 13 91664149 missense probably damaging 1.00
X0026:Ssbp2 UTSW 13 91669688 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TACAAACTTGACTCTCATGGTGC -3'
(R):5'- TTTGAGAAGGCGACATAAAACACAC -3'

Sequencing Primer
(F):5'- ACTCTCATGGTGCATGGC -3'
(R):5'- GGCGACATAAAACACACATTTGCG -3'
Posted On2015-03-18