Incidental Mutation 'R3744:Vmn2r97'
ID271139
Institutional Source Beutler Lab
Gene Symbol Vmn2r97
Ensembl Gene ENSMUSG00000091491
Gene Namevomeronasal 2, receptor 97
SynonymsEG627367
MMRRC Submission 040730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3744 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location18914300-18958087 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18929628 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 426 (H426R)
Ref Sequence ENSEMBL: ENSMUSP00000156141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168710] [ENSMUST00000232219]
Predicted Effect probably benign
Transcript: ENSMUST00000168710
AA Change: H426R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129313
Gene: ENSMUSG00000091491
AA Change: H426R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 82 442 2.9e-36 PFAM
Pfam:NCD3G 513 566 4.9e-21 PFAM
Pfam:7tm_3 599 834 1.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232219
AA Change: H426R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232325
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,111,216 probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
BC004004 A G 17: 29,301,449 *349W probably null Het
Elmo2 C T 2: 165,316,002 D39N probably damaging Het
Fam161a T C 11: 23,020,410 F196S probably damaging Het
Fam186a A G 15: 99,947,535 V276A unknown Het
Fn3krp T C 11: 121,426,705 probably null Het
Gnai3 T C 3: 108,109,398 probably benign Het
Hspg2 C T 4: 137,565,504 probably benign Het
Igkv5-45 G A 6: 69,775,937 H54Y probably benign Het
Kif26b A G 1: 178,679,030 I224V probably benign Het
Lyg1 T C 1: 37,949,842 Y99C probably benign Het
Myh4 C T 11: 67,255,315 R1400C probably damaging Het
Nf1 T C 11: 79,548,747 S2262P probably benign Het
Pop5 T C 5: 115,240,508 Y117H possibly damaging Het
Prpf8 T A 11: 75,506,721 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rapgef6 T C 11: 54,625,934 F54S probably benign Het
Sptb T C 12: 76,600,400 T1954A probably benign Het
Ssbp2 T C 13: 91,680,646 probably benign Het
Tap1 A T 17: 34,193,612 D541V probably damaging Het
Tcte1 A G 17: 45,539,671 D291G probably damaging Het
Tpbg A G 9: 85,845,162 R395G probably damaging Het
Trappc10 T A 10: 78,199,090 S941C probably benign Het
Usp19 G A 9: 108,500,181 R886Q probably damaging Het
Utp14b G T 1: 78,665,256 E290D probably benign Het
Vmn1r30 A T 6: 58,435,819 Y9* probably null Het
Vwa3a A G 7: 120,752,594 D27G probably benign Het
Zfp36 A G 7: 28,377,776 S236P probably benign Het
Zfp616 C A 11: 74,083,987 H452N probably benign Het
Other mutations in Vmn2r97
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r97 APN 17 18947659 missense probably benign 0.37
IGL00962:Vmn2r97 APN 17 18929228 missense probably damaging 1.00
IGL01704:Vmn2r97 APN 17 18947811 missense probably damaging 0.99
IGL01888:Vmn2r97 APN 17 18929024 nonsense probably null
IGL02429:Vmn2r97 APN 17 18930334 missense possibly damaging 0.94
IGL02742:Vmn2r97 APN 17 18929170 missense probably damaging 0.97
IGL02934:Vmn2r97 APN 17 18929685 missense probably benign 0.00
IGL02978:Vmn2r97 APN 17 18948036 missense probably benign 0.01
IGL03230:Vmn2r97 APN 17 18929406 missense probably benign 0.10
IGL03241:Vmn2r97 APN 17 18928176 missense probably benign 0.11
IGL03050:Vmn2r97 UTSW 17 18947638 missense possibly damaging 0.84
R0482:Vmn2r97 UTSW 17 18947668 missense probably damaging 1.00
R0514:Vmn2r97 UTSW 17 18914472 missense probably benign 0.25
R0944:Vmn2r97 UTSW 17 18947403 missense probably benign 0.13
R1061:Vmn2r97 UTSW 17 18928178 nonsense probably null
R1546:Vmn2r97 UTSW 17 18947848 missense probably damaging 1.00
R1725:Vmn2r97 UTSW 17 18929135 missense probably benign 0.43
R1860:Vmn2r97 UTSW 17 18947386 missense probably benign 0.01
R1938:Vmn2r97 UTSW 17 18929331 missense probably benign 0.01
R1944:Vmn2r97 UTSW 17 18940238 missense probably benign 0.00
R2027:Vmn2r97 UTSW 17 18929682 missense unknown
R2106:Vmn2r97 UTSW 17 18947838 missense probably damaging 1.00
R2151:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2153:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2154:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2516:Vmn2r97 UTSW 17 18947552 missense probably benign
R3739:Vmn2r97 UTSW 17 18928151 missense probably damaging 1.00
R3885:Vmn2r97 UTSW 17 18928334 missense possibly damaging 0.90
R3899:Vmn2r97 UTSW 17 18947611 missense probably damaging 0.96
R4115:Vmn2r97 UTSW 17 18928070 missense probably benign 0.01
R4247:Vmn2r97 UTSW 17 18947280 missense possibly damaging 0.83
R4287:Vmn2r97 UTSW 17 18948075 intron probably benign
R4439:Vmn2r97 UTSW 17 18930354 missense probably benign 0.00
R4523:Vmn2r97 UTSW 17 18929071 missense probably benign 0.03
R4783:Vmn2r97 UTSW 17 18929288 missense probably benign
R4948:Vmn2r97 UTSW 17 18947299 missense possibly damaging 0.95
R4981:Vmn2r97 UTSW 17 18940174 nonsense probably null
R5029:Vmn2r97 UTSW 17 18947911 missense probably damaging 1.00
R5200:Vmn2r97 UTSW 17 18928353 missense probably damaging 1.00
R5541:Vmn2r97 UTSW 17 18928355 nonsense probably null
R5637:Vmn2r97 UTSW 17 18947366 nonsense probably null
R5765:Vmn2r97 UTSW 17 18947180 nonsense probably null
R5885:Vmn2r97 UTSW 17 18947773 missense possibly damaging 0.50
R6272:Vmn2r97 UTSW 17 18947599 missense possibly damaging 0.70
R6553:Vmn2r97 UTSW 17 18930304 nonsense probably null
R6818:Vmn2r97 UTSW 17 18947931 missense possibly damaging 0.95
R6880:Vmn2r97 UTSW 17 18914508 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAAGTGCTCATTTTCTGACAC -3'
(R):5'- ACCTTGCCCATGATTTCAAAAC -3'

Sequencing Primer
(F):5'- AGTGCTCATTTTCTGACACTAATTG -3'
(R):5'- TGCCCATGATTTCAAAACATCATAC -3'
Posted On2015-03-18