Incidental Mutation 'R3744:BC004004'
ID271140
Institutional Source Beutler Lab
Gene Symbol BC004004
Ensembl Gene ENSMUSG00000052712
Gene NamecDNA sequence BC004004
Synonyms
MMRRC Submission 040730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R3744 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location29268788-29302881 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 29301449 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 349 (*349W)
Ref Sequence ENSEMBL: ENSMUSP00000117309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064709] [ENSMUST00000120346] [ENSMUST00000149405]
Predicted Effect probably null
Transcript: ENSMUST00000064709
AA Change: *349W
SMART Domains Protein: ENSMUSP00000066224
Gene: ENSMUSG00000052712
AA Change: *349W

DomainStartEndE-ValueType
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 222 236 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120346
AA Change: *349W
SMART Domains Protein: ENSMUSP00000113315
Gene: ENSMUSG00000052712
AA Change: *349W

DomainStartEndE-ValueType
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 222 236 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000149405
AA Change: *349W
SMART Domains Protein: ENSMUSP00000117309
Gene: ENSMUSG00000052712
AA Change: *349W

DomainStartEndE-ValueType
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 222 236 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150874
Meta Mutation Damage Score 0.404 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (33/33)
MGI Phenotype PHENOTYPE: Phenotypic analysis of mice homozygous for a gene trap allele indicates this mutation has no notable phenotype in any parameter tested. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,111,216 probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
Elmo2 C T 2: 165,316,002 D39N probably damaging Het
Fam161a T C 11: 23,020,410 F196S probably damaging Het
Fam186a A G 15: 99,947,535 V276A unknown Het
Fn3krp T C 11: 121,426,705 probably null Het
Gnai3 T C 3: 108,109,398 probably benign Het
Hspg2 C T 4: 137,565,504 probably benign Het
Igkv5-45 G A 6: 69,775,937 H54Y probably benign Het
Kif26b A G 1: 178,679,030 I224V probably benign Het
Lyg1 T C 1: 37,949,842 Y99C probably benign Het
Myh4 C T 11: 67,255,315 R1400C probably damaging Het
Nf1 T C 11: 79,548,747 S2262P probably benign Het
Pop5 T C 5: 115,240,508 Y117H possibly damaging Het
Prpf8 T A 11: 75,506,721 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rapgef6 T C 11: 54,625,934 F54S probably benign Het
Sptb T C 12: 76,600,400 T1954A probably benign Het
Ssbp2 T C 13: 91,680,646 probably benign Het
Tap1 A T 17: 34,193,612 D541V probably damaging Het
Tcte1 A G 17: 45,539,671 D291G probably damaging Het
Tpbg A G 9: 85,845,162 R395G probably damaging Het
Trappc10 T A 10: 78,199,090 S941C probably benign Het
Usp19 G A 9: 108,500,181 R886Q probably damaging Het
Utp14b G T 1: 78,665,256 E290D probably benign Het
Vmn1r30 A T 6: 58,435,819 Y9* probably null Het
Vmn2r97 A G 17: 18,929,628 H426R probably benign Het
Vwa3a A G 7: 120,752,594 D27G probably benign Het
Zfp36 A G 7: 28,377,776 S236P probably benign Het
Zfp616 C A 11: 74,083,987 H452N probably benign Het
Other mutations in BC004004
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:BC004004 APN 17 29282251 missense probably damaging 1.00
IGL01454:BC004004 APN 17 29294021 missense possibly damaging 0.76
IGL02437:BC004004 APN 17 29298697 missense probably damaging 0.99
R0677:BC004004 UTSW 17 29298664 missense probably damaging 1.00
R1440:BC004004 UTSW 17 29296691 critical splice donor site probably null
R4017:BC004004 UTSW 17 29298732 missense probably damaging 0.98
R4417:BC004004 UTSW 17 29282275 splice site probably benign
R4883:BC004004 UTSW 17 29282192 missense probably damaging 1.00
R5071:BC004004 UTSW 17 29294415 critical splice donor site probably null
R5619:BC004004 UTSW 17 29282729 missense probably damaging 1.00
R5768:BC004004 UTSW 17 29282735 missense probably damaging 1.00
R5846:BC004004 UTSW 17 29282308 intron probably benign
R6259:BC004004 UTSW 17 29298712 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCCCAGAGACCTTCAGAGTAAG -3'
(R):5'- CAGGCTTCCATCTTTCCTGAGG -3'

Sequencing Primer
(F):5'- GACCTTCAGAGTAAGAGCAGCC -3'
(R):5'- TCTTTCCTGAGGAAGCTACAGACAG -3'
Posted On2015-03-18