Incidental Mutation 'R3744:Abcg1'
ID271141
Institutional Source Beutler Lab
Gene Symbol Abcg1
Ensembl Gene ENSMUSG00000024030
Gene NameATP binding cassette subfamily G member 1
SynonymsWhite, Abc8
MMRRC Submission 040730-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.432) question?
Stock #R3744 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location31057698-31115777 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 31111216 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024829]
Predicted Effect probably benign
Transcript: ENSMUST00000024829
SMART Domains Protein: ENSMUSP00000024829
Gene: ENSMUSG00000024030

DomainStartEndE-ValueType
low complexity region 28 47 N/A INTRINSIC
AAA 110 293 1.28e-14 SMART
Pfam:ABC2_membrane 391 602 1.4e-48 PFAM
transmembrane domain 636 658 N/A INTRINSIC
Meta Mutation Damage Score 0.1124 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. The human protein is involved in macrophage cholesterol efflux and may regulate cellular lipid homeostasis in other cell types. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal lipid homeostasis, increased numbers of multiple immune cell types, and abnormal response to a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
BC004004 A G 17: 29,301,449 *349W probably null Het
Elmo2 C T 2: 165,316,002 D39N probably damaging Het
Fam161a T C 11: 23,020,410 F196S probably damaging Het
Fam186a A G 15: 99,947,535 V276A unknown Het
Fn3krp T C 11: 121,426,705 probably null Het
Gnai3 T C 3: 108,109,398 probably benign Het
Hspg2 C T 4: 137,565,504 probably benign Het
Igkv5-45 G A 6: 69,775,937 H54Y probably benign Het
Kif26b A G 1: 178,679,030 I224V probably benign Het
Lyg1 T C 1: 37,949,842 Y99C probably benign Het
Myh4 C T 11: 67,255,315 R1400C probably damaging Het
Nf1 T C 11: 79,548,747 S2262P probably benign Het
Pop5 T C 5: 115,240,508 Y117H possibly damaging Het
Prpf8 T A 11: 75,506,721 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rapgef6 T C 11: 54,625,934 F54S probably benign Het
Sptb T C 12: 76,600,400 T1954A probably benign Het
Ssbp2 T C 13: 91,680,646 probably benign Het
Tap1 A T 17: 34,193,612 D541V probably damaging Het
Tcte1 A G 17: 45,539,671 D291G probably damaging Het
Tpbg A G 9: 85,845,162 R395G probably damaging Het
Trappc10 T A 10: 78,199,090 S941C probably benign Het
Usp19 G A 9: 108,500,181 R886Q probably damaging Het
Utp14b G T 1: 78,665,256 E290D probably benign Het
Vmn1r30 A T 6: 58,435,819 Y9* probably null Het
Vmn2r97 A G 17: 18,929,628 H426R probably benign Het
Vwa3a A G 7: 120,752,594 D27G probably benign Het
Zfp36 A G 7: 28,377,776 S236P probably benign Het
Zfp616 C A 11: 74,083,987 H452N probably benign Het
Other mutations in Abcg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01962:Abcg1 APN 17 31105540 missense probably benign 0.11
IGL02496:Abcg1 APN 17 31105604 missense probably damaging 0.98
IGL03264:Abcg1 APN 17 31064454 missense probably benign 0.10
R0682:Abcg1 UTSW 17 31111251 missense probably benign 0.13
R1036:Abcg1 UTSW 17 31111269 missense probably damaging 1.00
R1109:Abcg1 UTSW 17 31111236 missense probably benign 0.01
R1401:Abcg1 UTSW 17 31114158 missense possibly damaging 0.93
R1500:Abcg1 UTSW 17 31111279 missense probably benign 0.11
R2187:Abcg1 UTSW 17 31105517 missense probably damaging 0.99
R2504:Abcg1 UTSW 17 31092395 missense probably damaging 0.98
R4632:Abcg1 UTSW 17 31064473 missense probably benign
R4657:Abcg1 UTSW 17 31108434 missense probably benign 0.13
R4679:Abcg1 UTSW 17 31114261 missense probably benign 0.31
R4845:Abcg1 UTSW 17 31114083 missense possibly damaging 0.94
R5061:Abcg1 UTSW 17 31092392 missense probably damaging 1.00
R5685:Abcg1 UTSW 17 31098286 nonsense probably null
R6743:Abcg1 UTSW 17 31108347 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCGATGTCCCCTTTCAGGTATG -3'
(R):5'- CCCATAGTTAGACGGAGGAGAC -3'

Sequencing Primer
(F):5'- TATGCGAGCCACCAAGTGATTTG -3'
(R):5'- AGCACTTCCTCGGCTGTAC -3'
Posted On2015-03-18